Incidental Mutation 'R2141:Tmub2'
ID236287
Institutional Source Beutler Lab
Gene Symbol Tmub2
Ensembl Gene ENSMUSG00000034757
Gene Nametransmembrane and ubiquitin-like domain containing 2
Synonyms
MMRRC Submission 040144-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2141 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102284931-102289237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102287553 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 94 (E94G)
Ref Sequence ENSEMBL: ENSMUSP00000116327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036376] [ENSMUST00000073234] [ENSMUST00000107132] [ENSMUST00000107134] [ENSMUST00000137387] [ENSMUST00000156326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036376
AA Change: E94G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047600
Gene: ENSMUSG00000034757
AA Change: E94G

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073234
SMART Domains Protein: ENSMUSP00000072967
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000100387
AA Change: E132G
SMART Domains Protein: ENSMUSP00000097956
Gene: ENSMUSG00000034757
AA Change: E132G

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
UBQ 212 281 1.75e-9 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107132
SMART Domains Protein: ENSMUSP00000102750
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.1e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 209 246 7.8e-11 PFAM
low complexity region 282 295 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107134
SMART Domains Protein: ENSMUSP00000102752
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135551
Predicted Effect probably benign
Transcript: ENSMUST00000137387
SMART Domains Protein: ENSMUSP00000122610
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 76 108 2.6e-21 PFAM
low complexity region 131 139 N/A INTRINSIC
low complexity region 146 155 N/A INTRINSIC
Pfam:SCA7 205 242 1.9e-9 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 331 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141516
SMART Domains Protein: ENSMUSP00000121917
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 27 35 N/A INTRINSIC
low complexity region 42 51 N/A INTRINSIC
Pfam:SCA7 113 150 6.7e-11 PFAM
low complexity region 186 199 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156077
Predicted Effect possibly damaging
Transcript: ENSMUST00000156326
AA Change: E94G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116327
Gene: ENSMUSG00000034757
AA Change: E94G

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: This gene encodes a predicted multi-pass membrane protein that features a C-terminal ubiquitin-related domain. This gene may be expressed in cone photoreceptors in the retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik G T 11: 58,423,926 C150F probably damaging Het
4932431P20Rik T C 7: 29,531,510 noncoding transcript Het
Aagab T A 9: 63,616,675 probably null Het
Abca15 A C 7: 120,407,474 T1654P probably damaging Het
Abca17 T A 17: 24,334,266 Y157F probably benign Het
Aftph A T 11: 20,698,318 L813* probably null Het
Agap1 T C 1: 89,837,755 I615T probably damaging Het
Ak3 T G 19: 29,022,847 Q221H probably benign Het
Aldoa A G 7: 126,797,642 probably null Het
Anxa8 T C 14: 34,091,916 probably null Het
Baz2a A G 10: 128,123,612 D1329G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep70 A G 9: 99,296,385 Y512C probably damaging Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Diablo A G 5: 123,523,361 V24A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fam173b T C 15: 31,609,572 F146L probably benign Het
Fam26f G T 10: 34,127,695 A72E probably damaging Het
Fancd2 A G 6: 113,549,321 N335S probably benign Het
Flnc A G 6: 29,448,675 Y1304C probably damaging Het
Fubp3 A G 2: 31,600,557 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gjc3 A C 5: 137,957,546 L159R probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm21957 G T 7: 125,219,453 noncoding transcript Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5885 A G 6: 133,529,275 noncoding transcript Het
Gm8989 T A 7: 106,329,956 T245S probably damaging Het
Gon4l A T 3: 88,887,595 T402S possibly damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Impdh2 A G 9: 108,565,347 E305G possibly damaging Het
Ints7 T A 1: 191,604,860 C351S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Kcnq3 T C 15: 65,995,851 M648V probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Klhl36 T C 8: 119,876,772 C589R possibly damaging Het
Lck A G 4: 129,548,920 Y481H probably damaging Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Myo18b T C 5: 112,874,026 K500R probably benign Het
N4bp2l2 A T 5: 150,647,536 I458N probably damaging Het
Nat10 T C 2: 103,731,303 probably null Het
Nfasc G A 1: 132,596,645 P932L probably damaging Het
Nipa1 C A 7: 55,997,511 probably null Het
Nkpd1 A G 7: 19,524,237 Q647R probably damaging Het
Nlrc4 T A 17: 74,447,951 probably benign Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1025-ps1 A G 2: 85,918,827 I301V probably null Het
Olfr1173 A G 2: 88,275,010 V13A probably benign Het
Olfr1289 A T 2: 111,483,630 T95S probably benign Het
Olfr770 A G 10: 129,133,006 I254T probably benign Het
Optc A T 1: 133,903,796 probably null Het
Pank1 G A 19: 34,878,980 R33C possibly damaging Het
Pcmtd1 C T 1: 7,169,565 R77C probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Pramel7 T A 2: 87,489,977 H324L probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Rai1 C A 11: 60,189,467 S1452R possibly damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rufy2 G T 10: 62,990,994 R104L probably damaging Het
Senp6 T A 9: 80,123,820 N8K probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Sipa1l2 G A 8: 125,491,491 P369L probably benign Het
Slc43a1 T C 2: 84,840,961 L37P probably damaging Het
Slf1 T A 13: 77,049,219 probably null Het
Ssr2 T A 3: 88,576,642 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tbx18 A G 9: 87,715,653 V276A probably damaging Het
Tie1 G A 4: 118,472,811 R1072* probably null Het
Tm2d2 C A 8: 25,022,658 T174K probably damaging Het
Tmem98 A G 11: 80,814,332 D82G possibly damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Tonsl A T 15: 76,632,661 I923N probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc21a G A 9: 119,964,295 V977M probably damaging Het
Ube2ql1 T C 13: 69,738,664 D226G probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Zadh2 T C 18: 84,094,543 Y115H probably benign Het
Zfp408 A G 2: 91,647,849 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp804b A G 5: 6,772,583 V160A probably benign Het
Zfp960 A G 17: 17,087,884 T287A probably benign Het
Other mutations in Tmub2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0115:Tmub2 UTSW 11 102288375 unclassified probably null
R0332:Tmub2 UTSW 11 102288348 missense probably damaging 1.00
R1168:Tmub2 UTSW 11 102287370 missense possibly damaging 0.77
R1530:Tmub2 UTSW 11 102287486 missense probably benign 0.01
R2420:Tmub2 UTSW 11 102287755 missense probably benign
R2421:Tmub2 UTSW 11 102287755 missense probably benign
R3717:Tmub2 UTSW 11 102285061 unclassified probably benign
R4660:Tmub2 UTSW 11 102285019 unclassified probably benign
R5238:Tmub2 UTSW 11 102284994 unclassified probably benign
R5444:Tmub2 UTSW 11 102288240 missense possibly damaging 0.80
R6590:Tmub2 UTSW 11 102287519 missense probably damaging 1.00
R6690:Tmub2 UTSW 11 102287519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGCTCTCTGATGTCACC -3'
(R):5'- GCAGGAGCCATCATCTAACC -3'

Sequencing Primer
(F):5'- TCTGATGTCACCCTCATTGAG -3'
(R):5'- GGAGCCATCATCTAACCCCAGC -3'
Posted On2014-10-01