Incidental Mutation 'R2141:Abca17'
ID 236297
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A member 17
Synonyms
MMRRC Submission 040144-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2141 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 24483233-24570042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24553240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 157 (Y157F)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: Y157F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: Y157F

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: Y157F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: Y157F

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (107/110)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik G T 11: 58,314,752 (GRCm39) C150F probably damaging Het
Aagab T A 9: 63,523,957 (GRCm39) probably null Het
Abca15 A C 7: 120,006,697 (GRCm39) T1654P probably damaging Het
Aftph A T 11: 20,648,318 (GRCm39) L813* probably null Het
Agap1 T C 1: 89,765,477 (GRCm39) I615T probably damaging Het
Ak3 T G 19: 29,000,247 (GRCm39) Q221H probably benign Het
Aldoa A G 7: 126,396,814 (GRCm39) probably null Het
Anxa8 T C 14: 33,813,873 (GRCm39) probably null Het
Atpsckmt T C 15: 31,609,718 (GRCm39) F146L probably benign Het
Baz2a A G 10: 127,959,481 (GRCm39) D1329G probably damaging Het
Calhm6 G T 10: 34,003,691 (GRCm39) A72E probably damaging Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cep70 A G 9: 99,178,438 (GRCm39) Y512C probably damaging Het
Cfhr2 T G 1: 139,758,893 (GRCm39) R52S probably benign Het
Clcn6 A G 4: 148,108,594 (GRCm39) F145S possibly damaging Het
Cnksr1 A G 4: 133,956,939 (GRCm39) Y488H probably damaging Het
Diablo A G 5: 123,661,424 (GRCm39) V24A probably benign Het
Dnah7b T A 1: 46,307,830 (GRCm39) M3048K probably damaging Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Efnb1 A G X: 98,191,123 (GRCm39) Y343C probably damaging Het
Esco1 A G 18: 10,574,873 (GRCm39) probably null Het
Fancd2 A G 6: 113,526,282 (GRCm39) N335S probably benign Het
Flnc A G 6: 29,448,674 (GRCm39) Y1304C probably damaging Het
Fubp3 A G 2: 31,490,569 (GRCm39) probably benign Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gjc3 A C 5: 137,955,808 (GRCm39) L159R probably damaging Het
Gli1 A G 10: 127,172,596 (GRCm39) L182P probably damaging Het
Gm21957 G T 7: 124,818,625 (GRCm39) noncoding transcript Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,255,059 (GRCm39) probably benign Het
Gm5885 A G 6: 133,506,238 (GRCm39) noncoding transcript Het
Gon4l A T 3: 88,794,902 (GRCm39) T402S possibly damaging Het
Gprasp1 G A X: 134,702,791 (GRCm39) E995K possibly damaging Het
Gvin-ps5 T A 7: 105,929,163 (GRCm39) T245S probably damaging Het
Helb A T 10: 119,941,926 (GRCm39) M254K possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Igfn1 AGGG AGG 1: 135,902,590 (GRCm39) probably benign Het
Impdh2 A G 9: 108,442,546 (GRCm39) E305G possibly damaging Het
Ints7 T A 1: 191,336,972 (GRCm39) C351S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Kcnq3 T C 15: 65,867,700 (GRCm39) M648V probably benign Het
Kctd16 A G 18: 40,392,231 (GRCm39) E273G possibly damaging Het
Kif18a T A 2: 109,163,848 (GRCm39) N732K probably benign Het
Kif21b C T 1: 136,080,002 (GRCm39) R513W probably damaging Het
Klhl36 T C 8: 120,603,511 (GRCm39) C589R possibly damaging Het
Lck A G 4: 129,442,713 (GRCm39) Y481H probably damaging Het
Lmtk2 A G 5: 144,084,433 (GRCm39) Y156C probably damaging Het
Mical3 A T 6: 121,008,095 (GRCm39) probably null Het
Mki67 A G 7: 135,297,321 (GRCm39) I2571T possibly damaging Het
Mx2 G A 16: 97,339,903 (GRCm39) E20K probably benign Het
Myo10 A G 15: 25,714,194 (GRCm39) E87G probably benign Het
Myo18b T C 5: 113,021,892 (GRCm39) K500R probably benign Het
N4bp2l2 A T 5: 150,571,001 (GRCm39) I458N probably damaging Het
Nat10 T C 2: 103,561,648 (GRCm39) probably null Het
Nfasc G A 1: 132,524,383 (GRCm39) P932L probably damaging Het
Nipa1 C A 7: 55,647,259 (GRCm39) probably null Het
Nkpd1 A G 7: 19,258,162 (GRCm39) Q647R probably damaging Het
Nlrc4 T A 17: 74,754,946 (GRCm39) probably benign Het
Nmbr C A 10: 14,646,186 (GRCm39) Y353* probably null Het
Nos1ap T A 1: 170,156,735 (GRCm39) D241V probably damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or4f4b A T 2: 111,313,975 (GRCm39) T95S probably benign Het
Or5d43 A G 2: 88,105,354 (GRCm39) V13A probably benign Het
Or5m13 A G 2: 85,749,171 (GRCm39) I301V probably null Het
Or6c201 A G 10: 128,968,875 (GRCm39) I254T probably benign Het
Pank1 G A 19: 34,856,380 (GRCm39) R33C possibly damaging Het
Pcmtd1 C T 1: 7,239,789 (GRCm39) R77C probably damaging Het
Phkg2 G A 7: 127,181,386 (GRCm39) probably null Het
Plcb4 G A 2: 135,818,019 (GRCm39) V762M probably damaging Het
Pramel7 T A 2: 87,320,321 (GRCm39) H324L probably damaging Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptgr3 T C 18: 84,112,668 (GRCm39) Y115H probably benign Het
Rai1 C A 11: 60,080,293 (GRCm39) S1452R possibly damaging Het
Ren1 C G 1: 133,278,516 (GRCm39) probably null Het
Rev3l T C 10: 39,724,045 (GRCm39) V785A probably benign Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Rufy2 G T 10: 62,826,773 (GRCm39) R104L probably damaging Het
Senp6 T A 9: 80,031,102 (GRCm39) N8K probably damaging Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Sipa1l2 G A 8: 126,218,230 (GRCm39) P369L probably benign Het
Slc43a1 T C 2: 84,671,305 (GRCm39) L37P probably damaging Het
Slf1 T A 13: 77,197,338 (GRCm39) probably null Het
Ssr2 T A 3: 88,483,949 (GRCm39) probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,674,479 (GRCm39) probably benign Het
Tas2r115 T C 6: 132,714,321 (GRCm39) K210R probably benign Het
Tbx18 A G 9: 87,597,706 (GRCm39) V276A probably damaging Het
Tesl1 T A X: 23,773,549 (GRCm39) V350E probably benign Het
Tie1 G A 4: 118,330,008 (GRCm39) R1072* probably null Het
Tm2d2 C A 8: 25,512,674 (GRCm39) T174K probably damaging Het
Tmem98 A G 11: 80,705,158 (GRCm39) D82G possibly damaging Het
Tmub2 A G 11: 102,178,379 (GRCm39) E94G possibly damaging Het
Tnnt2 TG TGG 1: 135,774,499 (GRCm39) probably benign Het
Tonsl A T 15: 76,516,861 (GRCm39) I923N probably damaging Het
Ttc21a G A 9: 119,793,361 (GRCm39) V977M probably damaging Het
Ube2ql1 T C 13: 69,886,783 (GRCm39) D226G probably damaging Het
Ubr4 C T 4: 139,204,518 (GRCm39) T4810M probably damaging Het
Wdr87-ps T C 7: 29,230,935 (GRCm39) noncoding transcript Het
Zfp408 A G 2: 91,478,194 (GRCm39) probably benign Het
Zfp473 T C 7: 44,382,501 (GRCm39) T610A possibly damaging Het
Zfp804b A G 5: 6,822,583 (GRCm39) V160A probably benign Het
Zfp960 A G 17: 17,308,146 (GRCm39) T287A probably benign Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24,514,165 (GRCm39) missense probably benign 0.14
IGL00585:Abca17 APN 17 24,519,294 (GRCm39) missense probably damaging 0.99
IGL00941:Abca17 APN 17 24,536,104 (GRCm39) missense probably damaging 1.00
IGL01987:Abca17 APN 17 24,565,202 (GRCm39) missense probably benign 0.00
IGL01988:Abca17 APN 17 24,553,229 (GRCm39) missense probably damaging 0.99
IGL02223:Abca17 APN 17 24,506,909 (GRCm39) nonsense probably null
IGL02368:Abca17 APN 17 24,506,767 (GRCm39) missense probably benign 0.01
IGL02405:Abca17 APN 17 24,498,036 (GRCm39) missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24,517,958 (GRCm39) missense probably benign 0.05
IGL02607:Abca17 APN 17 24,546,679 (GRCm39) nonsense probably null
IGL02706:Abca17 APN 17 24,517,966 (GRCm39) missense probably benign 0.00
IGL02729:Abca17 APN 17 24,499,455 (GRCm39) missense probably benign 0.06
IGL02818:Abca17 APN 17 24,519,326 (GRCm39) missense probably benign 0.02
IGL02891:Abca17 APN 17 24,500,340 (GRCm39) missense probably damaging 0.99
IGL03236:Abca17 APN 17 24,545,450 (GRCm39) splice site probably benign
IGL03299:Abca17 APN 17 24,484,565 (GRCm39) missense probably damaging 1.00
basin UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
Bowl UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R0018:Abca17 UTSW 17 24,532,162 (GRCm39) splice site probably null
R0467:Abca17 UTSW 17 24,532,151 (GRCm39) splice site probably benign
R0671:Abca17 UTSW 17 24,500,223 (GRCm39) missense probably benign 0.00
R1175:Abca17 UTSW 17 24,508,325 (GRCm39) missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24,504,733 (GRCm39) missense probably benign 0.18
R1398:Abca17 UTSW 17 24,547,511 (GRCm39) missense probably damaging 0.96
R1678:Abca17 UTSW 17 24,554,594 (GRCm39) missense probably benign 0.05
R1696:Abca17 UTSW 17 24,486,632 (GRCm39) missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24,486,531 (GRCm39) missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24,486,690 (GRCm39) missense probably damaging 1.00
R1970:Abca17 UTSW 17 24,526,549 (GRCm39) missense probably benign 0.00
R1997:Abca17 UTSW 17 24,504,700 (GRCm39) missense probably benign 0.02
R2199:Abca17 UTSW 17 24,554,598 (GRCm39) missense probably benign 0.19
R2394:Abca17 UTSW 17 24,500,190 (GRCm39) splice site probably null
R2442:Abca17 UTSW 17 24,547,606 (GRCm39) missense probably benign 0.02
R2509:Abca17 UTSW 17 24,508,587 (GRCm39) splice site probably benign
R2848:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2849:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2859:Abca17 UTSW 17 24,500,288 (GRCm39) missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2935:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3153:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3154:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3434:Abca17 UTSW 17 24,508,511 (GRCm39) missense probably damaging 1.00
R3695:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3905:Abca17 UTSW 17 24,515,257 (GRCm39) missense probably benign 0.13
R4282:Abca17 UTSW 17 24,518,034 (GRCm39) missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24,537,242 (GRCm39) missense probably damaging 1.00
R4350:Abca17 UTSW 17 24,498,020 (GRCm39) critical splice donor site probably null
R4548:Abca17 UTSW 17 24,553,245 (GRCm39) missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24,540,058 (GRCm39) missense probably damaging 1.00
R4722:Abca17 UTSW 17 24,484,403 (GRCm39) missense probably damaging 1.00
R4745:Abca17 UTSW 17 24,526,427 (GRCm39) missense probably damaging 1.00
R4818:Abca17 UTSW 17 24,536,135 (GRCm39) missense probably damaging 0.98
R5279:Abca17 UTSW 17 24,508,388 (GRCm39) missense probably damaging 1.00
R5310:Abca17 UTSW 17 24,500,204 (GRCm39) missense probably benign 0.00
R5320:Abca17 UTSW 17 24,526,541 (GRCm39) missense probably damaging 1.00
R5435:Abca17 UTSW 17 24,486,588 (GRCm39) missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24,546,642 (GRCm39) missense probably benign 0.14
R5776:Abca17 UTSW 17 24,514,132 (GRCm39) missense probably benign 0.09
R5928:Abca17 UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
R6013:Abca17 UTSW 17 24,506,820 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24,537,165 (GRCm39) missense probably benign 0.00
R6063:Abca17 UTSW 17 24,483,318 (GRCm39) missense unknown
R6404:Abca17 UTSW 17 24,484,892 (GRCm39) missense probably benign 0.13
R6746:Abca17 UTSW 17 24,565,195 (GRCm39) nonsense probably null
R6819:Abca17 UTSW 17 24,506,767 (GRCm39) missense probably benign 0.01
R6828:Abca17 UTSW 17 24,545,389 (GRCm39) missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24,484,474 (GRCm39) missense probably damaging 1.00
R7065:Abca17 UTSW 17 24,546,725 (GRCm39) missense probably damaging 1.00
R7123:Abca17 UTSW 17 24,484,949 (GRCm39) missense probably damaging 1.00
R7157:Abca17 UTSW 17 24,554,564 (GRCm39) missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24,554,600 (GRCm39) missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24,539,983 (GRCm39) missense not run
R7352:Abca17 UTSW 17 24,508,028 (GRCm39) nonsense probably null
R7355:Abca17 UTSW 17 24,486,621 (GRCm39) missense probably benign 0.00
R7358:Abca17 UTSW 17 24,510,529 (GRCm39) missense probably benign 0.00
R7411:Abca17 UTSW 17 24,547,543 (GRCm39) missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24,484,507 (GRCm39) missense probably damaging 1.00
R8039:Abca17 UTSW 17 24,547,699 (GRCm39) missense probably damaging 1.00
R8095:Abca17 UTSW 17 24,536,196 (GRCm39) missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24,486,657 (GRCm39) missense probably damaging 1.00
R8517:Abca17 UTSW 17 24,536,207 (GRCm39) missense probably benign 0.00
R8811:Abca17 UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R8819:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8820:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8953:Abca17 UTSW 17 24,518,015 (GRCm39) missense probably benign
R9095:Abca17 UTSW 17 24,500,370 (GRCm39) missense probably damaging 0.97
R9313:Abca17 UTSW 17 24,565,207 (GRCm39) missense probably benign 0.00
R9314:Abca17 UTSW 17 24,547,593 (GRCm39) missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24,483,479 (GRCm39) missense probably benign
R9351:Abca17 UTSW 17 24,510,751 (GRCm39) missense probably benign 0.00
R9387:Abca17 UTSW 17 24,553,255 (GRCm39) missense probably benign 0.02
R9388:Abca17 UTSW 17 24,483,273 (GRCm39) missense unknown
R9440:Abca17 UTSW 17 24,499,452 (GRCm39) missense probably benign 0.02
R9498:Abca17 UTSW 17 24,484,480 (GRCm39) missense probably damaging 1.00
R9654:Abca17 UTSW 17 24,536,099 (GRCm39) missense probably benign 0.09
R9709:Abca17 UTSW 17 24,517,934 (GRCm39) missense probably benign
R9770:Abca17 UTSW 17 24,514,121 (GRCm39) missense probably benign 0.00
R9773:Abca17 UTSW 17 24,508,565 (GRCm39) missense probably damaging 1.00
RF024:Abca17 UTSW 17 24,506,706 (GRCm39) frame shift probably null
RF029:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
RF032:Abca17 UTSW 17 24,506,701 (GRCm39) frame shift probably null
RF036:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
X0017:Abca17 UTSW 17 24,536,137 (GRCm39) missense probably benign 0.26
X0065:Abca17 UTSW 17 24,553,258 (GRCm39) missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24,498,081 (GRCm39) missense probably benign 0.03
Z1088:Abca17 UTSW 17 24,498,053 (GRCm39) missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24,565,193 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTAATGTCACAGTAATGCCACAG -3'
(R):5'- ATTTTCCCATGTTGGTCACAGG -3'

Sequencing Primer
(F):5'- GCCACAGGCTTCAGAGTTTC -3'
(R):5'- CATGTTGGTCACAGGGATAATTTCC -3'
Posted On 2014-10-01