Incidental Mutation 'R0201:Nlrp2'
ID23635
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene NameNLR family, pyrin domain containing 2
SynonymsNbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
MMRRC Submission 038458-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0201 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5298547-5351035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5328329 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 356 (G356D)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
Predicted Effect probably benign
Transcript: ENSMUST00000045022
AA Change: G356D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: G356D

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,581,957 probably null Het
Adamts16 T A 13: 70,779,644 Q492L possibly damaging Het
Aplnr A G 2: 85,137,177 D182G probably damaging Het
Arnt2 G T 7: 84,361,659 S3* probably null Het
Asxl3 T C 18: 22,523,154 V1407A probably benign Het
Atg13 A T 2: 91,684,762 probably null Het
Atm A T 9: 53,454,279 probably benign Het
Birc6 T G 17: 74,609,327 V1746G possibly damaging Het
Cbln1 G T 8: 87,472,113 T43K probably benign Het
Cbx5 T C 15: 103,199,700 T173A probably damaging Het
Cc2d2a A G 5: 43,737,512 Y1437C probably damaging Het
Ccdc78 C A 17: 25,789,236 probably benign Het
Cd2bp2 A G 7: 127,193,828 Y341H probably damaging Het
Cdhr5 T A 7: 141,276,378 D88V probably damaging Het
Ces1f T A 8: 93,267,329 T275S probably null Het
Clca4a T C 3: 144,960,717 N458S probably benign Het
Cog5 A G 12: 31,839,841 K521R probably damaging Het
Csf2ra T A 19: 61,225,568 T305S probably benign Het
Csmd3 T A 15: 47,619,729 probably benign Het
Cts6 T A 13: 61,201,499 R132* probably null Het
D5Ertd579e G T 5: 36,616,465 N195K probably damaging Het
Ddx1 A G 12: 13,223,808 V606A probably damaging Het
Dip2b G A 15: 100,186,147 D884N probably damaging Het
Ehhadh A G 16: 21,773,493 probably null Het
Enpp1 T A 10: 24,653,917 T608S probably benign Het
Fancm T C 12: 65,101,632 Y674H probably damaging Het
Fat4 T A 3: 38,891,596 V1546D probably damaging Het
Fsd1 G A 17: 55,990,522 A158T probably benign Het
Fzd2 T A 11: 102,606,122 M464K probably damaging Het
Gjc2 A G 11: 59,177,590 F22S possibly damaging Het
Gm13101 T C 4: 143,964,890 E421G probably damaging Het
Gria2 T C 3: 80,707,838 Y445C probably damaging Het
Hsdl1 T A 8: 119,566,256 I147F possibly damaging Het
Ifi44 T C 3: 151,745,636 Y226C probably damaging Het
Il16 A G 7: 83,722,308 C97R probably damaging Het
Impg1 A T 9: 80,345,561 S369T probably damaging Het
Jmjd1c A G 10: 67,219,109 T390A unknown Het
Lgi1 A G 19: 38,301,293 E269G possibly damaging Het
Lrp6 G T 6: 134,450,897 Y1577* probably null Het
Lrrc74a G T 12: 86,761,773 probably benign Het
Man1c1 A T 4: 134,640,398 probably null Het
Map1lc3b A C 8: 121,590,550 Q9P possibly damaging Het
Mboat1 G A 13: 30,202,375 R124H probably benign Het
Mcu A G 10: 59,456,677 L60P probably damaging Het
Mrs2 G T 13: 25,018,534 Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Neb G A 2: 52,206,878 probably benign Het
Notch3 A G 17: 32,156,148 probably benign Het
Npr2 A C 4: 43,641,617 S474R probably damaging Het
Nupl1 A G 14: 60,244,616 F100L probably benign Het
Osbpl6 A C 2: 76,546,042 D87A possibly damaging Het
Pabpc2 A T 18: 39,775,307 M542L probably benign Het
Papln A G 12: 83,783,027 probably benign Het
Parpbp T C 10: 88,092,896 I561V possibly damaging Het
Pcdhb13 C T 18: 37,442,581 A4V probably benign Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Poldip3 T A 15: 83,135,296 M182L probably benign Het
Por T C 5: 135,731,178 S240P possibly damaging Het
Pramef20 A T 4: 144,377,273 probably benign Het
Prss22 A T 17: 23,996,301 V167D probably damaging Het
Prss37 A C 6: 40,516,349 L61R probably damaging Het
Psmd1 C T 1: 86,118,616 T702M probably benign Het
Pxdn G T 12: 30,002,431 G869V possibly damaging Het
Rabgap1l A G 1: 160,453,745 probably benign Het
Rapgef6 T C 11: 54,619,941 V228A probably damaging Het
Rnf169 T C 7: 99,926,003 R462G possibly damaging Het
Rnft2 A G 5: 118,194,680 probably benign Het
Sgo2b T C 8: 63,926,636 D1054G probably benign Het
Sh3bgr T C 16: 96,228,517 probably benign Het
Slc12a4 A G 8: 105,945,350 V910A possibly damaging Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Spty2d1 G A 7: 46,997,901 R427* probably null Het
Ssc5d A G 7: 4,944,663 T1339A probably benign Het
Sspo A C 6: 48,455,752 E854A possibly damaging Het
Stx7 A G 10: 24,185,079 probably benign Het
Styk1 A T 6: 131,301,730 probably benign Het
Tex33 T A 15: 78,378,828 M209L probably damaging Het
Tmem163 T G 1: 127,668,637 probably benign Het
Tmppe C CT 9: 114,404,639 probably null Het
Tmx2 A G 2: 84,673,082 V229A probably benign Het
Top2b T C 14: 16,383,174 L54P probably damaging Het
Trim62 A T 4: 128,902,550 Y280F probably benign Het
Tssk4 A T 14: 55,651,559 K181* probably null Het
Tssk4 A T 14: 55,651,560 K181M probably damaging Het
Ubn1 A G 16: 5,064,614 D313G probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 splice site probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5317469 critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5319168 missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5328528 missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5327651 missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5317495 missense probably benign 0.40
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCAAGAGACTATTGGCAGCCAGG -3'
(R):5'- ACTGGGCAGTTTGCTGAAGAGG -3'

Sequencing Primer
(F):5'- CTCATTGAGATGGTCCTCACAGG -3'
(R):5'- GGAAGATGGCACCTCATGC -3'
Posted On2013-04-16