Incidental Mutation 'R2142:Rab11fip5'
ID236363
Institutional Source Beutler Lab
Gene Symbol Rab11fip5
Ensembl Gene ENSMUSG00000051343
Gene NameRAB11 family interacting protein 5 (class I)
SynonymsRIP11, D6Ertd32e, GAF1, 9130206P09Rik
MMRRC Submission 040145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2142 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85334962-85374634 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 85337228 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045846] [ENSMUST00000059034] [ENSMUST00000060837] [ENSMUST00000060837] [ENSMUST00000113787] [ENSMUST00000113788] [ENSMUST00000204087] [ENSMUST00000204087]
Predicted Effect probably benign
Transcript: ENSMUST00000045846
SMART Domains Protein: ENSMUSP00000041872
Gene: ENSMUSG00000033720

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Mtc 34 342 2.5e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059034
SMART Domains Protein: ENSMUSP00000054648
Gene: ENSMUSG00000033720

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Mtc 34 292 2.1e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000060837
SMART Domains Protein: ENSMUSP00000058305
Gene: ENSMUSG00000051343

DomainStartEndE-ValueType
C2 20 143 8.7e-7 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
Pfam:RBD-FIP 593 640 5.1e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000060837
SMART Domains Protein: ENSMUSP00000058305
Gene: ENSMUSG00000051343

DomainStartEndE-ValueType
C2 20 143 8.7e-7 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
Pfam:RBD-FIP 593 640 5.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102058
Predicted Effect probably benign
Transcript: ENSMUST00000113787
Predicted Effect probably benign
Transcript: ENSMUST00000113788
SMART Domains Protein: ENSMUSP00000109418
Gene: ENSMUSG00000033720

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Mtc 34 89 6.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203035
Predicted Effect probably null
Transcript: ENSMUST00000204087
SMART Domains Protein: ENSMUSP00000145402
Gene: ENSMUSG00000051343

DomainStartEndE-ValueType
C2 20 143 5.8e-9 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
low complexity region 529 547 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 687 692 N/A INTRINSIC
low complexity region 713 732 N/A INTRINSIC
low complexity region 852 887 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 1037 1052 N/A INTRINSIC
low complexity region 1068 1106 N/A INTRINSIC
low complexity region 1115 1149 N/A INTRINSIC
Pfam:RBD-FIP 1266 1313 8.5e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204087
SMART Domains Protein: ENSMUSP00000145402
Gene: ENSMUSG00000051343

DomainStartEndE-ValueType
C2 20 143 5.8e-9 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
low complexity region 529 547 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 687 692 N/A INTRINSIC
low complexity region 713 732 N/A INTRINSIC
low complexity region 852 887 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 1037 1052 N/A INTRINSIC
low complexity region 1068 1106 N/A INTRINSIC
low complexity region 1115 1149 N/A INTRINSIC
Pfam:RBD-FIP 1266 1313 8.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204504
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,616,675 probably null Het
Adgrb3 G T 1: 25,068,209 P640T probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Angpt2 T C 8: 18,714,140 T129A probably benign Het
Atp6v0a4 T A 6: 38,082,936 K236* probably null Het
Baz1b G A 5: 135,217,275 R526H probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Btnl9 G T 11: 49,170,626 probably null Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cdh8 C A 8: 99,111,693 C505F probably damaging Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Ces1c T A 8: 93,130,840 I38F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Col25a1 A G 3: 130,570,316 H546R probably damaging Het
Crot A T 5: 8,987,780 Y179N possibly damaging Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Ddb1 T C 19: 10,619,126 probably null Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Elf2 A G 3: 51,256,440 V496A probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fbn1 T G 2: 125,412,708 T212P possibly damaging Het
Fuca2 A G 10: 13,505,865 Y174C probably damaging Het
Gabarap C T 11: 69,991,689 probably benign Het
Gdf2 A G 14: 33,945,241 T307A probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm266 C T 12: 111,485,181 R197K possibly damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gns G A 10: 121,392,778 R498H probably damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Grk6 T C 13: 55,454,364 W335R probably damaging Het
Helz2 T C 2: 181,231,380 E2379G probably benign Het
Hmx2 A T 7: 131,555,859 D234V probably damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTTCT 1: 135,386,282 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Itpkc A G 7: 27,219,650 V397A possibly damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kdr T C 5: 75,968,423 T188A possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Man1a T C 10: 53,934,998 N338S probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Micall1 T C 15: 79,130,795 Y751H probably damaging Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myh2 A G 11: 67,189,332 E1124G probably damaging Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Nat10 T C 2: 103,731,303 probably null Het
Nipa1 C A 7: 55,997,511 probably null Het
Nrbp1 A G 5: 31,247,929 E287G possibly damaging Het
Nup188 T A 2: 30,336,706 I1165N possibly damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1012 C T 2: 85,759,677 R233H probably benign Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1298 C A 2: 111,645,221 V259L probably benign Het
Olfr1383 A G 11: 49,523,839 I39V probably benign Het
Olfr642 C T 7: 104,050,300 G18D probably damaging Het
Olfr786 A G 10: 129,437,747 K312E probably benign Het
Optc A T 1: 133,903,796 probably null Het
Panx3 G C 9: 37,666,673 S87W probably damaging Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pcdhb11 A G 18: 37,422,123 N169D probably benign Het
Pdzd2 C A 15: 12,406,559 G605V probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Pkhd1 T A 1: 20,523,895 K1331N probably benign Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Pot1a T C 6: 25,750,044 probably null Het
Prb1 T A 6: 132,207,203 Q489L unknown Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psme4 A G 11: 30,820,998 Y782C possibly damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rit2 A G 18: 31,153,713 F140L probably benign Het
Rorc G A 3: 94,389,526 R271Q probably benign Het
Sall3 A T 18: 80,969,831 M1130K probably damaging Het
Sart3 T C 5: 113,764,093 E141G probably damaging Het
Serpina9 T C 12: 104,008,309 D195G probably benign Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tarsl2 A T 7: 65,658,897 I272L probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tdpoz3 C T 3: 93,826,899 H294Y probably benign Het
Tigd4 A G 3: 84,594,363 T196A possibly damaging Het
Treh G A 9: 44,681,141 M54I probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uhrf1bp1l A G 10: 89,812,048 D207G probably damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp606 T C 7: 12,479,726 I4T probably damaging Het
Zfp638 T A 6: 83,986,596 N1918K probably damaging Het
Zfp65 G T 13: 67,708,192 H333N probably damaging Het
Other mutations in Rab11fip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Rab11fip5 APN 6 85337552 missense probably damaging 1.00
IGL02471:Rab11fip5 APN 6 85348225 missense probably damaging 0.99
IGL02725:Rab11fip5 APN 6 85374489 missense probably damaging 0.99
IGL02737:Rab11fip5 APN 6 85348558 missense probably damaging 1.00
PIT4812001:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R0627:Rab11fip5 UTSW 6 85348051 missense probably benign 0.05
R1652:Rab11fip5 UTSW 6 85348297 missense probably damaging 0.97
R1961:Rab11fip5 UTSW 6 85348991 missense possibly damaging 0.87
R2106:Rab11fip5 UTSW 6 85374387 missense probably damaging 0.98
R4729:Rab11fip5 UTSW 6 85374267 missense probably damaging 0.99
R5001:Rab11fip5 UTSW 6 85347806 missense probably damaging 1.00
R5116:Rab11fip5 UTSW 6 85348807 missense probably damaging 1.00
R5506:Rab11fip5 UTSW 6 85374137 missense probably damaging 1.00
R5801:Rab11fip5 UTSW 6 85337600 missense probably damaging 0.99
R6338:Rab11fip5 UTSW 6 85341378 missense possibly damaging 0.94
R6696:Rab11fip5 UTSW 6 85341946 missense possibly damaging 0.65
R6763:Rab11fip5 UTSW 6 85342170 missense probably benign 0.02
R6880:Rab11fip5 UTSW 6 85348845 missense probably damaging 0.99
R6932:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R7042:Rab11fip5 UTSW 6 85374128 missense possibly damaging 0.82
R7112:Rab11fip5 UTSW 6 85348194 missense probably damaging 1.00
R7197:Rab11fip5 UTSW 6 85342155 missense probably damaging 1.00
R7384:Rab11fip5 UTSW 6 85348330 missense possibly damaging 0.47
R7395:Rab11fip5 UTSW 6 85341868 missense probably benign
R7451:Rab11fip5 UTSW 6 85341556 missense probably benign 0.06
R7482:Rab11fip5 UTSW 6 85340778 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCAGGTGAGAGCAGTCAGTG -3'
(R):5'- TAACTGGTAATTCCCCGTGC -3'

Sequencing Primer
(F):5'- CCAGGGGAGATTTGCAGC -3'
(R):5'- CGTGCCACAGCTCTTAAGTG -3'
Posted On2014-10-01