Incidental Mutation 'R0201:Cdhr5'
ID 23641
Institutional Source Beutler Lab
Gene Symbol Cdhr5
Ensembl Gene ENSMUSG00000025497
Gene Name cadherin-related family member 5
Synonyms Mupcdh, Mucdhl, 1810074H01Rik
MMRRC Submission 038458-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R0201 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140848996-140856699 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140856291 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 88 (D88V)
Ref Sequence ENSEMBL: ENSMUSP00000079484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046156] [ENSMUST00000080654] [ENSMUST00000167263] [ENSMUST00000167790] [ENSMUST00000210124] [ENSMUST00000210773] [ENSMUST00000211667]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046156
SMART Domains Protein: ENSMUSP00000041519
Gene: ENSMUSG00000038580

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080654
AA Change: D88V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079484
Gene: ENSMUSG00000025497
AA Change: D88V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 3e-24 BLAST
transmembrane domain 478 500 N/A INTRINSIC
low complexity region 546 580 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167263
AA Change: D88V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127292
Gene: ENSMUSG00000025497
AA Change: D88V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 1e-24 BLAST
low complexity region 462 476 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
transmembrane domain 640 662 N/A INTRINSIC
low complexity region 708 742 N/A INTRINSIC
low complexity region 796 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167790
SMART Domains Protein: ENSMUSP00000128729
Gene: ENSMUSG00000038580

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210386
Predicted Effect probably benign
Transcript: ENSMUST00000210773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210928
Predicted Effect probably benign
Transcript: ENSMUST00000211667
Meta Mutation Damage Score 0.9205 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a novel mucin-like gene that is a member of the cadherin superfamily. While encoding nonpolymorphic tandem repeats rich in proline, serine and threonine similar to mucin proteins, the gene also contains sequence encoding calcium-binding motifs found in all cadherins. The role of the hybrid extracellular region and the specific function of this protein have not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,819,406 (GRCm39) probably null Het
Adamts16 T A 13: 70,927,763 (GRCm39) Q492L possibly damaging Het
Aplnr A G 2: 84,967,521 (GRCm39) D182G probably damaging Het
Arnt2 G T 7: 84,010,867 (GRCm39) S3* probably null Het
Asxl3 T C 18: 22,656,211 (GRCm39) V1407A probably benign Het
Atg13 A T 2: 91,515,107 (GRCm39) probably null Het
Atm A T 9: 53,365,579 (GRCm39) probably benign Het
Birc6 T G 17: 74,916,322 (GRCm39) V1746G possibly damaging Het
Cbln1 G T 8: 88,198,741 (GRCm39) T43K probably benign Het
Cbx5 T C 15: 103,108,127 (GRCm39) T173A probably damaging Het
Cc2d2a A G 5: 43,894,854 (GRCm39) Y1437C probably damaging Het
Ccdc78 C A 17: 26,008,210 (GRCm39) probably benign Het
Cd2bp2 A G 7: 126,793,000 (GRCm39) Y341H probably damaging Het
Ces1f T A 8: 93,993,957 (GRCm39) T275S probably null Het
Cimip4 T A 15: 78,263,028 (GRCm39) M209L probably damaging Het
Clca4a T C 3: 144,666,478 (GRCm39) N458S probably benign Het
Cog5 A G 12: 31,889,840 (GRCm39) K521R probably damaging Het
Csf2ra T A 19: 61,214,006 (GRCm39) T305S probably benign Het
Csmd3 T A 15: 47,483,125 (GRCm39) probably benign Het
Cts6 T A 13: 61,349,313 (GRCm39) R132* probably null Het
D5Ertd579e G T 5: 36,773,809 (GRCm39) N195K probably damaging Het
Ddx1 A G 12: 13,273,809 (GRCm39) V606A probably damaging Het
Dip2b G A 15: 100,084,028 (GRCm39) D884N probably damaging Het
Ehhadh A G 16: 21,592,243 (GRCm39) probably null Het
Enpp1 T A 10: 24,529,815 (GRCm39) T608S probably benign Het
Fancm T C 12: 65,148,406 (GRCm39) Y674H probably damaging Het
Fat4 T A 3: 38,945,745 (GRCm39) V1546D probably damaging Het
Fsd1 G A 17: 56,297,522 (GRCm39) A158T probably benign Het
Fzd2 T A 11: 102,496,948 (GRCm39) M464K probably damaging Het
Gjc2 A G 11: 59,068,416 (GRCm39) F22S possibly damaging Het
Gria2 T C 3: 80,615,145 (GRCm39) Y445C probably damaging Het
Hsdl1 T A 8: 120,292,995 (GRCm39) I147F possibly damaging Het
Ifi44 T C 3: 151,451,273 (GRCm39) Y226C probably damaging Het
Il16 A G 7: 83,371,516 (GRCm39) C97R probably damaging Het
Impg1 A T 9: 80,252,843 (GRCm39) S369T probably damaging Het
Jmjd1c A G 10: 67,054,888 (GRCm39) T390A unknown Het
Lgi1 A G 19: 38,289,741 (GRCm39) E269G possibly damaging Het
Lrp6 G T 6: 134,427,860 (GRCm39) Y1577* probably null Het
Lrrc74a G T 12: 86,808,547 (GRCm39) probably benign Het
Man1c1 A T 4: 134,367,709 (GRCm39) probably null Het
Map1lc3b A C 8: 122,317,289 (GRCm39) Q9P possibly damaging Het
Mboat1 G A 13: 30,386,358 (GRCm39) R124H probably benign Het
Mcu A G 10: 59,292,499 (GRCm39) L60P probably damaging Het
Mrs2 G T 13: 25,202,517 (GRCm39) Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Neb G A 2: 52,096,890 (GRCm39) probably benign Het
Nlrp2 C T 7: 5,331,328 (GRCm39) G356D probably benign Het
Notch3 A G 17: 32,375,122 (GRCm39) probably benign Het
Npr2 A C 4: 43,641,617 (GRCm39) S474R probably damaging Het
Nup58 A G 14: 60,482,065 (GRCm39) F100L probably benign Het
Osbpl6 A C 2: 76,376,386 (GRCm39) D87A possibly damaging Het
Pabpc2 A T 18: 39,908,360 (GRCm39) M542L probably benign Het
Papln A G 12: 83,829,801 (GRCm39) probably benign Het
Parpbp T C 10: 87,928,758 (GRCm39) I561V possibly damaging Het
Pcdhb13 C T 18: 37,575,634 (GRCm39) A4V probably benign Het
Pelp1 T C 11: 70,286,530 (GRCm39) T533A possibly damaging Het
Poldip3 T A 15: 83,019,497 (GRCm39) M182L probably benign Het
Por T C 5: 135,760,032 (GRCm39) S240P possibly damaging Het
Pramel15 A T 4: 144,103,843 (GRCm39) probably benign Het
Pramel28 T C 4: 143,691,460 (GRCm39) E421G probably damaging Het
Prss22 A T 17: 24,215,275 (GRCm39) V167D probably damaging Het
Prss37 A C 6: 40,493,283 (GRCm39) L61R probably damaging Het
Psmd1 C T 1: 86,046,338 (GRCm39) T702M probably benign Het
Pxdn G T 12: 30,052,430 (GRCm39) G869V possibly damaging Het
Rabgap1l A G 1: 160,281,315 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,510,767 (GRCm39) V228A probably damaging Het
Rnf169 T C 7: 99,575,210 (GRCm39) R462G possibly damaging Het
Rnft2 A G 5: 118,332,745 (GRCm39) probably benign Het
Sgo2b T C 8: 64,379,670 (GRCm39) D1054G probably benign Het
Sh3bgr T C 16: 96,029,717 (GRCm39) probably benign Het
Slc12a4 A G 8: 106,671,982 (GRCm39) V910A possibly damaging Het
Slc6a12 A T 6: 121,332,331 (GRCm39) I222F probably benign Het
Spty2d1 G A 7: 46,647,649 (GRCm39) R427* probably null Het
Ssc5d A G 7: 4,947,662 (GRCm39) T1339A probably benign Het
Sspo A C 6: 48,432,686 (GRCm39) E854A possibly damaging Het
Stx7 A G 10: 24,060,977 (GRCm39) probably benign Het
Styk1 A T 6: 131,278,693 (GRCm39) probably benign Het
Tmem163 T G 1: 127,596,374 (GRCm39) probably benign Het
Tmppe C CT 9: 114,233,707 (GRCm39) probably null Het
Tmx2 A G 2: 84,503,426 (GRCm39) V229A probably benign Het
Top2b T C 14: 16,383,174 (GRCm38) L54P probably damaging Het
Trim62 A T 4: 128,796,343 (GRCm39) Y280F probably benign Het
Tssk4 A T 14: 55,889,016 (GRCm39) K181* probably null Het
Tssk4 A T 14: 55,889,017 (GRCm39) K181M probably damaging Het
Ubn1 A G 16: 4,882,478 (GRCm39) D313G probably damaging Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Ugt1a10 C T 1: 88,145,971 (GRCm39) P473L probably damaging Het
Other mutations in Cdhr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Cdhr5 APN 7 140,849,894 (GRCm39) missense probably damaging 0.99
IGL02662:Cdhr5 APN 7 140,854,416 (GRCm39) missense possibly damaging 0.57
R0002:Cdhr5 UTSW 7 140,849,933 (GRCm39) splice site probably null
R0098:Cdhr5 UTSW 7 140,849,781 (GRCm39) missense probably damaging 1.00
R0494:Cdhr5 UTSW 7 140,852,431 (GRCm39) missense probably damaging 1.00
R0508:Cdhr5 UTSW 7 140,852,812 (GRCm39) missense probably benign 0.41
R0918:Cdhr5 UTSW 7 140,852,062 (GRCm39) missense probably damaging 1.00
R1570:Cdhr5 UTSW 7 140,851,682 (GRCm39) missense probably damaging 1.00
R1571:Cdhr5 UTSW 7 140,852,083 (GRCm39) missense probably damaging 1.00
R1838:Cdhr5 UTSW 7 140,852,516 (GRCm39) missense possibly damaging 0.93
R3912:Cdhr5 UTSW 7 140,853,770 (GRCm39) missense probably damaging 1.00
R4289:Cdhr5 UTSW 7 140,852,752 (GRCm39) missense probably damaging 0.99
R4491:Cdhr5 UTSW 7 140,853,970 (GRCm39) missense possibly damaging 0.55
R4838:Cdhr5 UTSW 7 140,853,644 (GRCm39) missense probably damaging 1.00
R4949:Cdhr5 UTSW 7 140,852,557 (GRCm39) missense probably damaging 0.97
R5187:Cdhr5 UTSW 7 140,854,361 (GRCm39) missense probably damaging 1.00
R5344:Cdhr5 UTSW 7 140,856,437 (GRCm39) missense probably damaging 0.97
R5642:Cdhr5 UTSW 7 140,849,110 (GRCm39) nonsense probably null
R6736:Cdhr5 UTSW 7 140,852,444 (GRCm39) missense probably damaging 0.97
R7172:Cdhr5 UTSW 7 140,851,841 (GRCm39) missense possibly damaging 0.90
R7212:Cdhr5 UTSW 7 140,852,572 (GRCm39) missense probably damaging 0.99
R7693:Cdhr5 UTSW 7 140,851,691 (GRCm39) missense probably benign
R8397:Cdhr5 UTSW 7 140,851,801 (GRCm39) missense possibly damaging 0.87
R8682:Cdhr5 UTSW 7 140,855,899 (GRCm39) critical splice donor site probably null
R8804:Cdhr5 UTSW 7 140,849,320 (GRCm39) missense probably benign 0.01
R9216:Cdhr5 UTSW 7 140,851,615 (GRCm39) missense possibly damaging 0.55
R9304:Cdhr5 UTSW 7 140,851,474 (GRCm39) missense probably benign 0.06
RF016:Cdhr5 UTSW 7 140,852,097 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCCACATAAGGAGCTATGCTGC -3'
(R):5'- TCTAGTCTGCTCTGTGAACCAGACC -3'

Sequencing Primer
(F):5'- AGCTATGCTGCTCTAGAACG -3'
(R):5'- GCTCTGTGAACCAGACCATATTTAG -3'
Posted On 2013-04-16