Incidental Mutation 'R0201:Cdhr5'
ID23641
Institutional Source Beutler Lab
Gene Symbol Cdhr5
Ensembl Gene ENSMUSG00000025497
Gene Namecadherin-related family member 5
Synonyms1810074H01Rik, Mupcdh, Mucdhl
MMRRC Submission 038458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0201 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141269083-141276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141276378 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 88 (D88V)
Ref Sequence ENSEMBL: ENSMUSP00000079484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046156] [ENSMUST00000080654] [ENSMUST00000167263] [ENSMUST00000167790] [ENSMUST00000210124] [ENSMUST00000210773] [ENSMUST00000211667]
Predicted Effect probably benign
Transcript: ENSMUST00000046156
SMART Domains Protein: ENSMUSP00000041519
Gene: ENSMUSG00000038580

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080654
AA Change: D88V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079484
Gene: ENSMUSG00000025497
AA Change: D88V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 3e-24 BLAST
transmembrane domain 478 500 N/A INTRINSIC
low complexity region 546 580 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167263
AA Change: D88V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127292
Gene: ENSMUSG00000025497
AA Change: D88V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 1e-24 BLAST
low complexity region 462 476 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
transmembrane domain 640 662 N/A INTRINSIC
low complexity region 708 742 N/A INTRINSIC
low complexity region 796 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167790
SMART Domains Protein: ENSMUSP00000128729
Gene: ENSMUSG00000038580

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210386
Predicted Effect probably benign
Transcript: ENSMUST00000210773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210928
Predicted Effect probably benign
Transcript: ENSMUST00000211667
Meta Mutation Damage Score 0.9205 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a novel mucin-like gene that is a member of the cadherin superfamily. While encoding nonpolymorphic tandem repeats rich in proline, serine and threonine similar to mucin proteins, the gene also contains sequence encoding calcium-binding motifs found in all cadherins. The role of the hybrid extracellular region and the specific function of this protein have not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,581,957 probably null Het
Adamts16 T A 13: 70,779,644 Q492L possibly damaging Het
Aplnr A G 2: 85,137,177 D182G probably damaging Het
Arnt2 G T 7: 84,361,659 S3* probably null Het
Asxl3 T C 18: 22,523,154 V1407A probably benign Het
Atg13 A T 2: 91,684,762 probably null Het
Atm A T 9: 53,454,279 probably benign Het
Birc6 T G 17: 74,609,327 V1746G possibly damaging Het
Cbln1 G T 8: 87,472,113 T43K probably benign Het
Cbx5 T C 15: 103,199,700 T173A probably damaging Het
Cc2d2a A G 5: 43,737,512 Y1437C probably damaging Het
Ccdc78 C A 17: 25,789,236 probably benign Het
Cd2bp2 A G 7: 127,193,828 Y341H probably damaging Het
Ces1f T A 8: 93,267,329 T275S probably null Het
Clca4a T C 3: 144,960,717 N458S probably benign Het
Cog5 A G 12: 31,839,841 K521R probably damaging Het
Csf2ra T A 19: 61,225,568 T305S probably benign Het
Csmd3 T A 15: 47,619,729 probably benign Het
Cts6 T A 13: 61,201,499 R132* probably null Het
D5Ertd579e G T 5: 36,616,465 N195K probably damaging Het
Ddx1 A G 12: 13,223,808 V606A probably damaging Het
Dip2b G A 15: 100,186,147 D884N probably damaging Het
Ehhadh A G 16: 21,773,493 probably null Het
Enpp1 T A 10: 24,653,917 T608S probably benign Het
Fancm T C 12: 65,101,632 Y674H probably damaging Het
Fat4 T A 3: 38,891,596 V1546D probably damaging Het
Fsd1 G A 17: 55,990,522 A158T probably benign Het
Fzd2 T A 11: 102,606,122 M464K probably damaging Het
Gjc2 A G 11: 59,177,590 F22S possibly damaging Het
Gm13101 T C 4: 143,964,890 E421G probably damaging Het
Gria2 T C 3: 80,707,838 Y445C probably damaging Het
Hsdl1 T A 8: 119,566,256 I147F possibly damaging Het
Ifi44 T C 3: 151,745,636 Y226C probably damaging Het
Il16 A G 7: 83,722,308 C97R probably damaging Het
Impg1 A T 9: 80,345,561 S369T probably damaging Het
Jmjd1c A G 10: 67,219,109 T390A unknown Het
Lgi1 A G 19: 38,301,293 E269G possibly damaging Het
Lrp6 G T 6: 134,450,897 Y1577* probably null Het
Lrrc74a G T 12: 86,761,773 probably benign Het
Man1c1 A T 4: 134,640,398 probably null Het
Map1lc3b A C 8: 121,590,550 Q9P possibly damaging Het
Mboat1 G A 13: 30,202,375 R124H probably benign Het
Mcu A G 10: 59,456,677 L60P probably damaging Het
Mrs2 G T 13: 25,018,534 Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Neb G A 2: 52,206,878 probably benign Het
Nlrp2 C T 7: 5,328,329 G356D probably benign Het
Notch3 A G 17: 32,156,148 probably benign Het
Npr2 A C 4: 43,641,617 S474R probably damaging Het
Nupl1 A G 14: 60,244,616 F100L probably benign Het
Osbpl6 A C 2: 76,546,042 D87A possibly damaging Het
Pabpc2 A T 18: 39,775,307 M542L probably benign Het
Papln A G 12: 83,783,027 probably benign Het
Parpbp T C 10: 88,092,896 I561V possibly damaging Het
Pcdhb13 C T 18: 37,442,581 A4V probably benign Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Poldip3 T A 15: 83,135,296 M182L probably benign Het
Por T C 5: 135,731,178 S240P possibly damaging Het
Pramef20 A T 4: 144,377,273 probably benign Het
Prss22 A T 17: 23,996,301 V167D probably damaging Het
Prss37 A C 6: 40,516,349 L61R probably damaging Het
Psmd1 C T 1: 86,118,616 T702M probably benign Het
Pxdn G T 12: 30,002,431 G869V possibly damaging Het
Rabgap1l A G 1: 160,453,745 probably benign Het
Rapgef6 T C 11: 54,619,941 V228A probably damaging Het
Rnf169 T C 7: 99,926,003 R462G possibly damaging Het
Rnft2 A G 5: 118,194,680 probably benign Het
Sgo2b T C 8: 63,926,636 D1054G probably benign Het
Sh3bgr T C 16: 96,228,517 probably benign Het
Slc12a4 A G 8: 105,945,350 V910A possibly damaging Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Spty2d1 G A 7: 46,997,901 R427* probably null Het
Ssc5d A G 7: 4,944,663 T1339A probably benign Het
Sspo A C 6: 48,455,752 E854A possibly damaging Het
Stx7 A G 10: 24,185,079 probably benign Het
Styk1 A T 6: 131,301,730 probably benign Het
Tex33 T A 15: 78,378,828 M209L probably damaging Het
Tmem163 T G 1: 127,668,637 probably benign Het
Tmppe C CT 9: 114,404,639 probably null Het
Tmx2 A G 2: 84,673,082 V229A probably benign Het
Top2b T C 14: 16,383,174 L54P probably damaging Het
Trim62 A T 4: 128,902,550 Y280F probably benign Het
Tssk4 A T 14: 55,651,559 K181* probably null Het
Tssk4 A T 14: 55,651,560 K181M probably damaging Het
Ubn1 A G 16: 5,064,614 D313G probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Other mutations in Cdhr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Cdhr5 APN 7 141269981 missense probably damaging 0.99
IGL02662:Cdhr5 APN 7 141274503 missense possibly damaging 0.57
R0002:Cdhr5 UTSW 7 141270020 splice site probably null
R0098:Cdhr5 UTSW 7 141269868 missense probably damaging 1.00
R0494:Cdhr5 UTSW 7 141272518 missense probably damaging 1.00
R0508:Cdhr5 UTSW 7 141272899 missense probably benign 0.41
R0918:Cdhr5 UTSW 7 141272149 missense probably damaging 1.00
R1570:Cdhr5 UTSW 7 141271769 missense probably damaging 1.00
R1571:Cdhr5 UTSW 7 141272170 missense probably damaging 1.00
R1838:Cdhr5 UTSW 7 141272603 missense possibly damaging 0.93
R3912:Cdhr5 UTSW 7 141273857 missense probably damaging 1.00
R4289:Cdhr5 UTSW 7 141272839 missense probably damaging 0.99
R4491:Cdhr5 UTSW 7 141274057 missense possibly damaging 0.55
R4838:Cdhr5 UTSW 7 141273731 missense probably damaging 1.00
R4949:Cdhr5 UTSW 7 141272644 missense probably damaging 0.97
R5187:Cdhr5 UTSW 7 141274448 missense probably damaging 1.00
R5344:Cdhr5 UTSW 7 141276524 missense probably damaging 0.97
R5642:Cdhr5 UTSW 7 141269197 nonsense probably null
R6736:Cdhr5 UTSW 7 141272531 missense probably damaging 0.97
R7172:Cdhr5 UTSW 7 141271928 missense possibly damaging 0.90
R7212:Cdhr5 UTSW 7 141272659 missense probably damaging 0.99
R7693:Cdhr5 UTSW 7 141271778 missense probably benign
RF016:Cdhr5 UTSW 7 141272184 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCCACATAAGGAGCTATGCTGC -3'
(R):5'- TCTAGTCTGCTCTGTGAACCAGACC -3'

Sequencing Primer
(F):5'- AGCTATGCTGCTCTAGAACG -3'
(R):5'- GCTCTGTGAACCAGACCATATTTAG -3'
Posted On2013-04-16