Incidental Mutation 'R2142:Myo10'
ID236412
Institutional Source Beutler Lab
Gene Symbol Myo10
Ensembl Gene ENSMUSG00000022272
Gene Namemyosin X
SynonymsD15Ertd600e, myosin-X
MMRRC Submission 040145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2142 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location25622525-25813673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25714108 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 87 (E87G)
Ref Sequence ENSEMBL: ENSMUSP00000118280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110457] [ENSMUST00000137601]
Predicted Effect probably benign
Transcript: ENSMUST00000110457
AA Change: E120G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: E120G

DomainStartEndE-ValueType
MYSc 57 740 N/A SMART
IQ 741 763 1.27e-3 SMART
IQ 764 786 1.06e0 SMART
IQ 787 809 7.07e-2 SMART
Pfam:MYO10_CC 881 932 4.2e-22 PFAM
low complexity region 959 981 N/A INTRINSIC
low complexity region 1090 1102 N/A INTRINSIC
low complexity region 1147 1165 N/A INTRINSIC
PH 1217 1316 1.39e-21 SMART
PH 1397 1503 6.76e-11 SMART
MyTH4 1551 1699 4.12e-37 SMART
B41 1700 1962 1.72e-44 SMART
low complexity region 2050 2062 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130517
Predicted Effect probably benign
Transcript: ENSMUST00000137601
AA Change: E87G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118280
Gene: ENSMUSG00000022272
AA Change: E87G

DomainStartEndE-ValueType
MYSc 24 707 N/A SMART
IQ 708 730 1.27e-3 SMART
IQ 731 753 1.06e0 SMART
IQ 754 776 7.07e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,616,675 probably null Het
Adgrb3 G T 1: 25,068,209 P640T probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Angpt2 T C 8: 18,714,140 T129A probably benign Het
Atp6v0a4 T A 6: 38,082,936 K236* probably null Het
Baz1b G A 5: 135,217,275 R526H probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Btnl9 G T 11: 49,170,626 probably null Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cdh8 C A 8: 99,111,693 C505F probably damaging Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Ces1c T A 8: 93,130,840 I38F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Col25a1 A G 3: 130,570,316 H546R probably damaging Het
Crot A T 5: 8,987,780 Y179N possibly damaging Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Ddb1 T C 19: 10,619,126 probably null Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Elf2 A G 3: 51,256,440 V496A probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fbn1 T G 2: 125,412,708 T212P possibly damaging Het
Fuca2 A G 10: 13,505,865 Y174C probably damaging Het
Gabarap C T 11: 69,991,689 probably benign Het
Gdf2 A G 14: 33,945,241 T307A probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm266 C T 12: 111,485,181 R197K possibly damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gns G A 10: 121,392,778 R498H probably damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Grk6 T C 13: 55,454,364 W335R probably damaging Het
Helz2 T C 2: 181,231,380 E2379G probably benign Het
Hmx2 A T 7: 131,555,859 D234V probably damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTTCT 1: 135,386,282 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Itpkc A G 7: 27,219,650 V397A possibly damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kdr T C 5: 75,968,423 T188A possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Man1a T C 10: 53,934,998 N338S probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Micall1 T C 15: 79,130,795 Y751H probably damaging Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myh2 A G 11: 67,189,332 E1124G probably damaging Het
Nat10 T C 2: 103,731,303 probably null Het
Nipa1 C A 7: 55,997,511 probably null Het
Nrbp1 A G 5: 31,247,929 E287G possibly damaging Het
Nup188 T A 2: 30,336,706 I1165N possibly damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1012 C T 2: 85,759,677 R233H probably benign Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1298 C A 2: 111,645,221 V259L probably benign Het
Olfr1383 A G 11: 49,523,839 I39V probably benign Het
Olfr642 C T 7: 104,050,300 G18D probably damaging Het
Olfr786 A G 10: 129,437,747 K312E probably benign Het
Optc A T 1: 133,903,796 probably null Het
Panx3 G C 9: 37,666,673 S87W probably damaging Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pcdhb11 A G 18: 37,422,123 N169D probably benign Het
Pdzd2 C A 15: 12,406,559 G605V probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Pkhd1 T A 1: 20,523,895 K1331N probably benign Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Pot1a T C 6: 25,750,044 probably null Het
Prb1 T A 6: 132,207,203 Q489L unknown Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psme4 A G 11: 30,820,998 Y782C possibly damaging Het
Rab11fip5 T C 6: 85,337,228 probably null Het
Ren1 C G 1: 133,350,778 probably null Het
Rit2 A G 18: 31,153,713 F140L probably benign Het
Rorc G A 3: 94,389,526 R271Q probably benign Het
Sall3 A T 18: 80,969,831 M1130K probably damaging Het
Sart3 T C 5: 113,764,093 E141G probably damaging Het
Serpina9 T C 12: 104,008,309 D195G probably benign Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tarsl2 A T 7: 65,658,897 I272L probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tdpoz3 C T 3: 93,826,899 H294Y probably benign Het
Tigd4 A G 3: 84,594,363 T196A possibly damaging Het
Treh G A 9: 44,681,141 M54I probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uhrf1bp1l A G 10: 89,812,048 D207G probably damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp606 T C 7: 12,479,726 I4T probably damaging Het
Zfp638 T A 6: 83,986,596 N1918K probably damaging Het
Zfp65 G T 13: 67,708,192 H333N probably damaging Het
Other mutations in Myo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Myo10 APN 15 25776380 missense probably damaging 1.00
IGL01068:Myo10 APN 15 25739309 missense possibly damaging 0.93
IGL01352:Myo10 APN 15 25701697 missense probably damaging 1.00
IGL01388:Myo10 APN 15 25736617 missense possibly damaging 0.55
IGL01460:Myo10 APN 15 25714108 missense probably benign 0.00
IGL01553:Myo10 APN 15 25776329 missense probably damaging 1.00
IGL01732:Myo10 APN 15 25732063 missense probably benign 0.10
IGL01992:Myo10 APN 15 25799548 missense possibly damaging 0.92
IGL02000:Myo10 APN 15 25808066 missense probably damaging 1.00
IGL02045:Myo10 APN 15 25726488 missense probably benign 0.03
IGL02307:Myo10 APN 15 25776315 splice site probably benign
IGL02511:Myo10 APN 15 25723889 missense probably damaging 0.97
IGL03240:Myo10 APN 15 25701602 missense probably damaging 1.00
R0037:Myo10 UTSW 15 25666532 intron probably benign
R0153:Myo10 UTSW 15 25781238 missense possibly damaging 0.84
R0282:Myo10 UTSW 15 25793167 missense probably damaging 1.00
R0360:Myo10 UTSW 15 25804368 missense probably damaging 1.00
R0585:Myo10 UTSW 15 25736455 missense probably damaging 1.00
R0617:Myo10 UTSW 15 25738005 missense probably damaging 1.00
R0729:Myo10 UTSW 15 25722157 splice site probably benign
R0771:Myo10 UTSW 15 25778178 missense probably damaging 1.00
R0960:Myo10 UTSW 15 25801189 missense probably damaging 1.00
R1562:Myo10 UTSW 15 25780411 missense possibly damaging 0.81
R1651:Myo10 UTSW 15 25742369 missense probably damaging 1.00
R1789:Myo10 UTSW 15 25726525 critical splice donor site probably null
R1816:Myo10 UTSW 15 25800200 missense probably damaging 1.00
R1835:Myo10 UTSW 15 25805587 missense possibly damaging 0.53
R1908:Myo10 UTSW 15 25801222 missense probably damaging 1.00
R2082:Myo10 UTSW 15 25785993 missense probably damaging 1.00
R2101:Myo10 UTSW 15 25722259 missense probably benign 0.26
R2129:Myo10 UTSW 15 25781799 missense probably benign 0.09
R2141:Myo10 UTSW 15 25714108 missense probably benign
R2920:Myo10 UTSW 15 25801140 missense probably damaging 1.00
R2938:Myo10 UTSW 15 25795717 missense probably damaging 0.99
R3723:Myo10 UTSW 15 25803288 missense probably damaging 1.00
R3852:Myo10 UTSW 15 25779626 missense probably damaging 1.00
R4162:Myo10 UTSW 15 25726415 splice site probably null
R4163:Myo10 UTSW 15 25726415 splice site probably null
R4164:Myo10 UTSW 15 25726415 splice site probably null
R4177:Myo10 UTSW 15 25734051 missense possibly damaging 0.81
R4409:Myo10 UTSW 15 25807869 missense probably damaging 1.00
R4667:Myo10 UTSW 15 25793153 missense possibly damaging 0.91
R4905:Myo10 UTSW 15 25800212 missense probably damaging 0.99
R4933:Myo10 UTSW 15 25781118 missense probably damaging 0.96
R4968:Myo10 UTSW 15 25808184 missense probably damaging 1.00
R5081:Myo10 UTSW 15 25785940 missense probably damaging 1.00
R5123:Myo10 UTSW 15 25726483 missense possibly damaging 0.94
R5310:Myo10 UTSW 15 25778078 splice site probably null
R6073:Myo10 UTSW 15 25736642 missense probably damaging 1.00
R6117:Myo10 UTSW 15 25805659 missense probably benign 0.00
R6185:Myo10 UTSW 15 25726510 missense probably damaging 0.99
R6749:Myo10 UTSW 15 25714110 missense probably damaging 1.00
R6819:Myo10 UTSW 15 25781410 missense possibly damaging 0.80
R6875:Myo10 UTSW 15 25805659 missense probably benign 0.00
R6908:Myo10 UTSW 15 25804383 missense probably damaging 1.00
R6963:Myo10 UTSW 15 25734063 missense probably benign 0.31
R7144:Myo10 UTSW 15 25723925 missense probably damaging 1.00
R7266:Myo10 UTSW 15 25782981 missense probably damaging 1.00
R7380:Myo10 UTSW 15 25779620 missense probably benign 0.01
R7460:Myo10 UTSW 15 25807827 missense probably damaging 1.00
R7614:Myo10 UTSW 15 25701623 missense probably benign 0.00
R7618:Myo10 UTSW 15 25726475 nonsense probably null
R7717:Myo10 UTSW 15 25731970 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATCATTTCGCTGGATCGCTCC -3'
(R):5'- ATCTGTCTGCAACTGAGCGC -3'

Sequencing Primer
(F):5'- CTGGATCGCTCCCGCCC -3'
(R):5'- AGCGCTCTCCAGTGAATG -3'
Posted On2014-10-01