Incidental Mutation 'R2142:Mx2'
ID236418
Institutional Source Beutler Lab
Gene Symbol Mx2
Ensembl Gene ENSMUSG00000023341
Gene NameMX dynamin-like GTPase 2
SynonymsMx-2
MMRRC Submission 040145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R2142 (G1)
Quality Score205
Status Not validated
Chromosome16
Chromosomal Location97535308-97560900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97538703 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 20 (E20K)
Ref Sequence ENSEMBL: ENSMUSP00000141038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024112] [ENSMUST00000188251] [ENSMUST00000190447]
Predicted Effect probably benign
Transcript: ENSMUST00000024112
AA Change: E20K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024112
Gene: ENSMUSG00000023341
AA Change: E20K

DomainStartEndE-ValueType
DYNc 39 282 2.71e-135 SMART
Blast:DYNc 426 539 4e-17 BLAST
GED 562 653 9.88e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188251
AA Change: E20K

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141038
Gene: ENSMUSG00000023341
AA Change: E20K

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
low complexity region 592 603 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190447
AA Change: E20K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140229
Gene: ENSMUSG00000023341
AA Change: E20K

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Mx1+ strains do not express MX2 protein. The Mx2 gene in BALB/cJ and CBA/J is interrupted by an open reading frame mutation. Mutagenesis correcting the frameshift permits Mx2 expression in 3T3 cells. This protein did not inhibit influenza virus but conferred resistance to vesicular stomatitis virus.
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,616,675 probably null Het
Adgrb3 G T 1: 25,068,209 P640T probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Angpt2 T C 8: 18,714,140 T129A probably benign Het
Atp6v0a4 T A 6: 38,082,936 K236* probably null Het
Baz1b G A 5: 135,217,275 R526H probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Btnl9 G T 11: 49,170,626 probably null Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cdh8 C A 8: 99,111,693 C505F probably damaging Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Ces1c T A 8: 93,130,840 I38F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Col25a1 A G 3: 130,570,316 H546R probably damaging Het
Crot A T 5: 8,987,780 Y179N possibly damaging Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Ddb1 T C 19: 10,619,126 probably null Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Elf2 A G 3: 51,256,440 V496A probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fbn1 T G 2: 125,412,708 T212P possibly damaging Het
Fuca2 A G 10: 13,505,865 Y174C probably damaging Het
Gabarap C T 11: 69,991,689 probably benign Het
Gdf2 A G 14: 33,945,241 T307A probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm266 C T 12: 111,485,181 R197K possibly damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gns G A 10: 121,392,778 R498H probably damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Grk6 T C 13: 55,454,364 W335R probably damaging Het
Helz2 T C 2: 181,231,380 E2379G probably benign Het
Hmx2 A T 7: 131,555,859 D234V probably damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTTCT 1: 135,386,282 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Itpkc A G 7: 27,219,650 V397A possibly damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kdr T C 5: 75,968,423 T188A possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Man1a T C 10: 53,934,998 N338S probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Micall1 T C 15: 79,130,795 Y751H probably damaging Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Myh2 A G 11: 67,189,332 E1124G probably damaging Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Nat10 T C 2: 103,731,303 probably null Het
Nipa1 C A 7: 55,997,511 probably null Het
Nrbp1 A G 5: 31,247,929 E287G possibly damaging Het
Nup188 T A 2: 30,336,706 I1165N possibly damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1012 C T 2: 85,759,677 R233H probably benign Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1298 C A 2: 111,645,221 V259L probably benign Het
Olfr1383 A G 11: 49,523,839 I39V probably benign Het
Olfr642 C T 7: 104,050,300 G18D probably damaging Het
Olfr786 A G 10: 129,437,747 K312E probably benign Het
Optc A T 1: 133,903,796 probably null Het
Panx3 G C 9: 37,666,673 S87W probably damaging Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pcdhb11 A G 18: 37,422,123 N169D probably benign Het
Pdzd2 C A 15: 12,406,559 G605V probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Pkhd1 T A 1: 20,523,895 K1331N probably benign Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Pot1a T C 6: 25,750,044 probably null Het
Prb1 T A 6: 132,207,203 Q489L unknown Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psme4 A G 11: 30,820,998 Y782C possibly damaging Het
Rab11fip5 T C 6: 85,337,228 probably null Het
Ren1 C G 1: 133,350,778 probably null Het
Rit2 A G 18: 31,153,713 F140L probably benign Het
Rorc G A 3: 94,389,526 R271Q probably benign Het
Sall3 A T 18: 80,969,831 M1130K probably damaging Het
Sart3 T C 5: 113,764,093 E141G probably damaging Het
Serpina9 T C 12: 104,008,309 D195G probably benign Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tarsl2 A T 7: 65,658,897 I272L probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tdpoz3 C T 3: 93,826,899 H294Y probably benign Het
Tigd4 A G 3: 84,594,363 T196A possibly damaging Het
Treh G A 9: 44,681,141 M54I probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uhrf1bp1l A G 10: 89,812,048 D207G probably damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp606 T C 7: 12,479,726 I4T probably damaging Het
Zfp638 T A 6: 83,986,596 N1918K probably damaging Het
Zfp65 G T 13: 67,708,192 H333N probably damaging Het
Other mutations in Mx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Mx2 APN 16 97544478 missense probably damaging 0.99
IGL01111:Mx2 APN 16 97558719 missense probably benign
IGL02103:Mx2 APN 16 97544595 missense probably damaging 1.00
IGL02678:Mx2 APN 16 97556120 critical splice donor site probably null
IGL03166:Mx2 APN 16 97546790 missense probably damaging 1.00
IGL03323:Mx2 APN 16 97546375 missense probably damaging 0.99
R0254:Mx2 UTSW 16 97556095 missense probably benign
R0699:Mx2 UTSW 16 97544553 missense probably damaging 1.00
R1180:Mx2 UTSW 16 97556009 missense probably damaging 1.00
R1702:Mx2 UTSW 16 97558683 missense probably benign
R1762:Mx2 UTSW 16 97538703 missense probably benign 0.09
R1922:Mx2 UTSW 16 97560351 missense probably benign 0.05
R2049:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2141:Mx2 UTSW 16 97538703 missense probably benign 0.09
R3010:Mx2 UTSW 16 97546799 missense possibly damaging 0.85
R4079:Mx2 UTSW 16 97556036 missense probably damaging 0.98
R4553:Mx2 UTSW 16 97552005 missense possibly damaging 0.52
R4594:Mx2 UTSW 16 97547432 nonsense probably null
R5211:Mx2 UTSW 16 97547433 missense probably damaging 1.00
R5785:Mx2 UTSW 16 97538704 missense possibly damaging 0.90
R6091:Mx2 UTSW 16 97546435 missense probably damaging 1.00
R7250:Mx2 UTSW 16 97547464 missense probably damaging 0.99
R7485:Mx2 UTSW 16 97545718 missense probably benign 0.11
R7793:Mx2 UTSW 16 97546883 missense probably damaging 1.00
R7816:Mx2 UTSW 16 97545612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATCCCCTCCCACATGAG -3'
(R):5'- GGACAACATTGCACTGTCCAG -3'

Sequencing Primer
(F):5'- CCAGAAGGACCCTGGGATG -3'
(R):5'- TTTCCCAGAGCAAGATAAAATCCTGG -3'
Posted On2014-10-01