Mutagenetix > Incidental Mutation

Incidental Mutation 'R0201:Sgo2b'

23642

Institutional Source

Beutler Lab

Gene Symbol

Sgo2b

Ensembl Gene

ENSMUSG00000094443

Gene Name

shugoshin 2B

Synonyms

Sgol2b, Gm4975

MMRRC Submission

038458-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R0201 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63924694-63952248 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63926636 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1054 (D1054G)

Ref Sequence

ENSEMBL: ENSMUSP00000136323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179944]

AlphaFold

J3QMK1

Predicted Effect

probably benign
Transcript: ENSMUST00000179944
AA Change: D1054G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: D1054G

Domain	Start	End	E-Value	Type
coiled coil region	54	113	N/A	INTRINSIC
low complexity region	122	135	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	400	414	N/A	INTRINSIC
internal_repeat_1	528	618	9.12e-8	PROSPERO
internal_repeat_1	713	809	9.12e-8	PROSPERO
low complexity region	1009	1024	N/A	INTRINSIC
low complexity region	1059	1081	N/A	INTRINSIC
low complexity region	1112	1126	N/A	INTRINSIC
low complexity region	1130	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210915

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.2%

Validation Efficiency

97% (91/94)

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,581,957		probably null	Het
Adamts16	T	A	13: 70,779,644	Q492L	possibly damaging	Het
Aplnr	A	G	2: 85,137,177	D182G	probably damaging	Het
Arnt2	G	T	7: 84,361,659	S3*	probably null	Het
Asxl3	T	C	18: 22,523,154	V1407A	probably benign	Het
Atg13	A	T	2: 91,684,762		probably null	Het
Atm	A	T	9: 53,454,279		probably benign	Het
Birc6	T	G	17: 74,609,327	V1746G	possibly damaging	Het
Cbln1	G	T	8: 87,472,113	T43K	probably benign	Het
Cbx5	T	C	15: 103,199,700	T173A	probably damaging	Het
Cc2d2a	A	G	5: 43,737,512	Y1437C	probably damaging	Het
Ccdc78	C	A	17: 25,789,236		probably benign	Het
Cd2bp2	A	G	7: 127,193,828	Y341H	probably damaging	Het
Cdhr5	T	A	7: 141,276,378	D88V	probably damaging	Het
Ces1f	T	A	8: 93,267,329	T275S	probably null	Het
Clca4a	T	C	3: 144,960,717	N458S	probably benign	Het
Cog5	A	G	12: 31,839,841	K521R	probably damaging	Het
Csf2ra	T	A	19: 61,225,568	T305S	probably benign	Het
Csmd3	T	A	15: 47,619,729		probably benign	Het
Cts6	T	A	13: 61,201,499	R132*	probably null	Het
D5Ertd579e	G	T	5: 36,616,465	N195K	probably damaging	Het
Ddx1	A	G	12: 13,223,808	V606A	probably damaging	Het
Dip2b	G	A	15: 100,186,147	D884N	probably damaging	Het
Ehhadh	A	G	16: 21,773,493		probably null	Het
Enpp1	T	A	10: 24,653,917	T608S	probably benign	Het
Fancm	T	C	12: 65,101,632	Y674H	probably damaging	Het
Fat4	T	A	3: 38,891,596	V1546D	probably damaging	Het
Fsd1	G	A	17: 55,990,522	A158T	probably benign	Het
Fzd2	T	A	11: 102,606,122	M464K	probably damaging	Het
Gjc2	A	G	11: 59,177,590	F22S	possibly damaging	Het
Gm13101	T	C	4: 143,964,890	E421G	probably damaging	Het
Gria2	T	C	3: 80,707,838	Y445C	probably damaging	Het
Hsdl1	T	A	8: 119,566,256	I147F	possibly damaging	Het
Ifi44	T	C	3: 151,745,636	Y226C	probably damaging	Het
Il16	A	G	7: 83,722,308	C97R	probably damaging	Het
Impg1	A	T	9: 80,345,561	S369T	probably damaging	Het
Jmjd1c	A	G	10: 67,219,109	T390A	unknown	Het
Lgi1	A	G	19: 38,301,293	E269G	possibly damaging	Het
Lrp6	G	T	6: 134,450,897	Y1577*	probably null	Het
Lrrc74a	G	T	12: 86,761,773		probably benign	Het
Man1c1	A	T	4: 134,640,398		probably null	Het
Map1lc3b	A	C	8: 121,590,550	Q9P	possibly damaging	Het
Mboat1	G	A	13: 30,202,375	R124H	probably benign	Het
Mcu	A	G	10: 59,456,677	L60P	probably damaging	Het
Mrs2	G	T	13: 25,018,534	Q75K	probably benign	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Neb	G	A	2: 52,206,878		probably benign	Het
Nlrp2	C	T	7: 5,328,329	G356D	probably benign	Het
Notch3	A	G	17: 32,156,148		probably benign	Het
Npr2	A	C	4: 43,641,617	S474R	probably damaging	Het
Nupl1	A	G	14: 60,244,616	F100L	probably benign	Het
Osbpl6	A	C	2: 76,546,042	D87A	possibly damaging	Het
Pabpc2	A	T	18: 39,775,307	M542L	probably benign	Het
Papln	A	G	12: 83,783,027		probably benign	Het
Parpbp	T	C	10: 88,092,896	I561V	possibly damaging	Het
Pcdhb13	C	T	18: 37,442,581	A4V	probably benign	Het
Pelp1	T	C	11: 70,395,704	T533A	possibly damaging	Het
Poldip3	T	A	15: 83,135,296	M182L	probably benign	Het
Por	T	C	5: 135,731,178	S240P	possibly damaging	Het
Pramef20	A	T	4: 144,377,273		probably benign	Het
Prss22	A	T	17: 23,996,301	V167D	probably damaging	Het
Prss37	A	C	6: 40,516,349	L61R	probably damaging	Het
Psmd1	C	T	1: 86,118,616	T702M	probably benign	Het
Pxdn	G	T	12: 30,002,431	G869V	possibly damaging	Het
Rabgap1l	A	G	1: 160,453,745		probably benign	Het
Rapgef6	T	C	11: 54,619,941	V228A	probably damaging	Het
Rnf169	T	C	7: 99,926,003	R462G	possibly damaging	Het
Rnft2	A	G	5: 118,194,680		probably benign	Het
Sh3bgr	T	C	16: 96,228,517		probably benign	Het
Slc12a4	A	G	8: 105,945,350	V910A	possibly damaging	Het
Slc6a12	A	T	6: 121,355,372	I222F	probably benign	Het
Spty2d1	G	A	7: 46,997,901	R427*	probably null	Het
Ssc5d	A	G	7: 4,944,663	T1339A	probably benign	Het
Sspo	A	C	6: 48,455,752	E854A	possibly damaging	Het
Stx7	A	G	10: 24,185,079		probably benign	Het
Styk1	A	T	6: 131,301,730		probably benign	Het
Tex33	T	A	15: 78,378,828	M209L	probably damaging	Het
Tmem163	T	G	1: 127,668,637		probably benign	Het
Tmppe	C	CT	9: 114,404,639		probably null	Het
Tmx2	A	G	2: 84,673,082	V229A	probably benign	Het
Top2b	T	C	14: 16,383,174	L54P	probably damaging	Het
Trim62	A	T	4: 128,902,550	Y280F	probably benign	Het
Tssk4	A	T	14: 55,651,559	K181*	probably null	Het
Tssk4	A	T	14: 55,651,560	K181M	probably damaging	Het
Ubn1	A	G	16: 5,064,614	D313G	probably damaging	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Ugt1a10	C	T	1: 88,218,249	P473L	probably damaging	Het

Other mutations in Sgo2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Sgo2b	APN	8	63926523	missense	probably benign
IGL01343:Sgo2b	APN	8	63927315	nonsense	probably null
IGL02027:Sgo2b	APN	8	63926829	missense	probably benign
IGL02090:Sgo2b	APN	8	63927089	missense	probably damaging	0.99
IGL02121:Sgo2b	APN	8	63931282	missense	possibly damaging	0.94
IGL02206:Sgo2b	APN	8	63941084	missense	possibly damaging	0.94
IGL02554:Sgo2b	APN	8	63926537	missense	probably damaging	0.96
IGL02663:Sgo2b	APN	8	63943114	missense	probably damaging	0.97
IGL03149:Sgo2b	APN	8	63926583	missense	probably benign	0.14
floater	UTSW	8	63938417	nonsense	probably null
R0164:Sgo2b	UTSW	8	63938383	missense	possibly damaging	0.92
R0164:Sgo2b	UTSW	8	63938383	missense	possibly damaging	0.92
R0285:Sgo2b	UTSW	8	63928789	nonsense	probably null
R0325:Sgo2b	UTSW	8	63928376	missense	probably benign	0.20
R0727:Sgo2b	UTSW	8	63927782	missense	probably damaging	0.98
R0943:Sgo2b	UTSW	8	63931335	missense	possibly damaging	0.82
R1148:Sgo2b	UTSW	8	63926855	missense	probably damaging	0.99
R1266:Sgo2b	UTSW	8	63928421	missense	probably benign	0.00
R1484:Sgo2b	UTSW	8	63931473	missense	possibly damaging	0.77
R1493:Sgo2b	UTSW	8	63926855	missense	probably damaging	0.99
R1537:Sgo2b	UTSW	8	63926502	missense	possibly damaging	0.94
R1630:Sgo2b	UTSW	8	63927797	missense	possibly damaging	0.90
R1803:Sgo2b	UTSW	8	63927392	missense	probably benign	0.01
R1912:Sgo2b	UTSW	8	63931469	missense	probably damaging	0.98
R1993:Sgo2b	UTSW	8	63926833	missense	probably benign	0.36
R2042:Sgo2b	UTSW	8	63928527	missense	probably benign
R2130:Sgo2b	UTSW	8	63927147	missense	probably benign	0.09
R2146:Sgo2b	UTSW	8	63928023	missense	probably benign	0.00
R2881:Sgo2b	UTSW	8	63927536	missense	probably damaging	0.99
R3686:Sgo2b	UTSW	8	63931327	missense	probably benign	0.20
R3706:Sgo2b	UTSW	8	63928145	missense	probably damaging	0.98
R3889:Sgo2b	UTSW	8	63927743	missense	possibly damaging	0.82
R3894:Sgo2b	UTSW	8	63928733	missense	possibly damaging	0.91
R3895:Sgo2b	UTSW	8	63928733	missense	possibly damaging	0.91
R4058:Sgo2b	UTSW	8	63926947	missense	probably damaging	0.98
R4259:Sgo2b	UTSW	8	63928296	missense	probably benign	0.06
R4260:Sgo2b	UTSW	8	63928296	missense	probably benign	0.06
R4704:Sgo2b	UTSW	8	63927790	missense	probably damaging	0.98
R4815:Sgo2b	UTSW	8	63931414	missense	probably benign
R4922:Sgo2b	UTSW	8	63926630	missense	possibly damaging	0.66
R5232:Sgo2b	UTSW	8	63928602	missense	possibly damaging	0.55
R5262:Sgo2b	UTSW	8	63943137	missense	probably damaging	0.99
R5444:Sgo2b	UTSW	8	63926556	missense	possibly damaging	0.90
R5677:Sgo2b	UTSW	8	63926974	missense	possibly damaging	0.77
R5959:Sgo2b	UTSW	8	63927288	missense	probably benign	0.01
R6004:Sgo2b	UTSW	8	63926673	nonsense	probably null
R6267:Sgo2b	UTSW	8	63927793	missense	probably benign
R6296:Sgo2b	UTSW	8	63927793	missense	probably benign
R6328:Sgo2b	UTSW	8	63928311	nonsense	probably null
R6517:Sgo2b	UTSW	8	63931494	missense	probably damaging	0.99
R6523:Sgo2b	UTSW	8	63927504	missense	probably benign	0.11
R6726:Sgo2b	UTSW	8	63927735	nonsense	probably null
R6957:Sgo2b	UTSW	8	63931455	small deletion	probably benign
R7031:Sgo2b	UTSW	8	63940044	missense	possibly damaging	0.94
R7034:Sgo2b	UTSW	8	63926834	missense	probably benign	0.36
R7145:Sgo2b	UTSW	8	63928184	missense	probably damaging	1.00
R7289:Sgo2b	UTSW	8	63941158	missense	probably damaging	0.97
R7366:Sgo2b	UTSW	8	63938417	nonsense	probably null
R7660:Sgo2b	UTSW	8	63940074	missense	probably benign	0.27
R7761:Sgo2b	UTSW	8	63926912	missense	probably benign
R7762:Sgo2b	UTSW	8	63926497	missense	probably benign	0.03
R7822:Sgo2b	UTSW	8	63927284	missense	probably damaging	0.98
R8111:Sgo2b	UTSW	8	63943104	missense	probably damaging	0.98
R8129:Sgo2b	UTSW	8	63928800	missense	possibly damaging	0.90
R8273:Sgo2b	UTSW	8	63924701	missense	unknown
R8856:Sgo2b	UTSW	8	63940057	missense	probably null	0.99
R9249:Sgo2b	UTSW	8	63938373	nonsense	probably null
R9428:Sgo2b	UTSW	8	63940033	missense	probably damaging	0.99
R9616:Sgo2b	UTSW	8	63927240	missense	probably benign
R9621:Sgo2b	UTSW	8	63927617	missense	probably damaging	0.99
RF014:Sgo2b	UTSW	8	63931405	missense	possibly damaging	0.94
RF055:Sgo2b	UTSW	8	63943169	missense	probably damaging	1.00
Z1088:Sgo2b	UTSW	8	63927005	missense	probably damaging	1.00
Z1088:Sgo2b	UTSW	8	63928422	missense	possibly damaging	0.61
Z1177:Sgo2b	UTSW	8	63927439	missense	probably benign	0.03
Z1177:Sgo2b	UTSW	8	63928385	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- ATATAAGCTGCTGGACTGAGCCCC -3'
(R):5'- GTTGACTCCCAACAGACTGAGAAGG -3'

Sequencing Primer
(F):5'- CTAAAACTCTGGCCTACCTGG -3'
(R):5'- CAGACTGAGAAGGAGAACTATTTGG -3'

Posted On

2013-04-16