Incidental Mutation 'R0201:Sgo2b'
ID23642
Institutional Source Beutler Lab
Gene Symbol Sgo2b
Ensembl Gene ENSMUSG00000094443
Gene Nameshugoshin 2B
SynonymsSgol2b, Gm4975
MMRRC Submission 038458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0201 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location63924694-63952248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63926636 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1054 (D1054G)
Ref Sequence ENSEMBL: ENSMUSP00000136323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179944]
Predicted Effect probably benign
Transcript: ENSMUST00000179944
AA Change: D1054G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: D1054G

DomainStartEndE-ValueType
coiled coil region 54 113 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
internal_repeat_1 528 618 9.12e-8 PROSPERO
internal_repeat_1 713 809 9.12e-8 PROSPERO
low complexity region 1009 1024 N/A INTRINSIC
low complexity region 1059 1081 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1130 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210915
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,581,957 probably null Het
Adamts16 T A 13: 70,779,644 Q492L possibly damaging Het
Aplnr A G 2: 85,137,177 D182G probably damaging Het
Arnt2 G T 7: 84,361,659 S3* probably null Het
Asxl3 T C 18: 22,523,154 V1407A probably benign Het
Atg13 A T 2: 91,684,762 probably null Het
Atm A T 9: 53,454,279 probably benign Het
Birc6 T G 17: 74,609,327 V1746G possibly damaging Het
Cbln1 G T 8: 87,472,113 T43K probably benign Het
Cbx5 T C 15: 103,199,700 T173A probably damaging Het
Cc2d2a A G 5: 43,737,512 Y1437C probably damaging Het
Ccdc78 C A 17: 25,789,236 probably benign Het
Cd2bp2 A G 7: 127,193,828 Y341H probably damaging Het
Cdhr5 T A 7: 141,276,378 D88V probably damaging Het
Ces1f T A 8: 93,267,329 T275S probably null Het
Clca4a T C 3: 144,960,717 N458S probably benign Het
Cog5 A G 12: 31,839,841 K521R probably damaging Het
Csf2ra T A 19: 61,225,568 T305S probably benign Het
Csmd3 T A 15: 47,619,729 probably benign Het
Cts6 T A 13: 61,201,499 R132* probably null Het
D5Ertd579e G T 5: 36,616,465 N195K probably damaging Het
Ddx1 A G 12: 13,223,808 V606A probably damaging Het
Dip2b G A 15: 100,186,147 D884N probably damaging Het
Ehhadh A G 16: 21,773,493 probably null Het
Enpp1 T A 10: 24,653,917 T608S probably benign Het
Fancm T C 12: 65,101,632 Y674H probably damaging Het
Fat4 T A 3: 38,891,596 V1546D probably damaging Het
Fsd1 G A 17: 55,990,522 A158T probably benign Het
Fzd2 T A 11: 102,606,122 M464K probably damaging Het
Gjc2 A G 11: 59,177,590 F22S possibly damaging Het
Gm13101 T C 4: 143,964,890 E421G probably damaging Het
Gria2 T C 3: 80,707,838 Y445C probably damaging Het
Hsdl1 T A 8: 119,566,256 I147F possibly damaging Het
Ifi44 T C 3: 151,745,636 Y226C probably damaging Het
Il16 A G 7: 83,722,308 C97R probably damaging Het
Impg1 A T 9: 80,345,561 S369T probably damaging Het
Jmjd1c A G 10: 67,219,109 T390A unknown Het
Lgi1 A G 19: 38,301,293 E269G possibly damaging Het
Lrp6 G T 6: 134,450,897 Y1577* probably null Het
Lrrc74a G T 12: 86,761,773 probably benign Het
Man1c1 A T 4: 134,640,398 probably null Het
Map1lc3b A C 8: 121,590,550 Q9P possibly damaging Het
Mboat1 G A 13: 30,202,375 R124H probably benign Het
Mcu A G 10: 59,456,677 L60P probably damaging Het
Mrs2 G T 13: 25,018,534 Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Neb G A 2: 52,206,878 probably benign Het
Nlrp2 C T 7: 5,328,329 G356D probably benign Het
Notch3 A G 17: 32,156,148 probably benign Het
Npr2 A C 4: 43,641,617 S474R probably damaging Het
Nupl1 A G 14: 60,244,616 F100L probably benign Het
Osbpl6 A C 2: 76,546,042 D87A possibly damaging Het
Pabpc2 A T 18: 39,775,307 M542L probably benign Het
Papln A G 12: 83,783,027 probably benign Het
Parpbp T C 10: 88,092,896 I561V possibly damaging Het
Pcdhb13 C T 18: 37,442,581 A4V probably benign Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Poldip3 T A 15: 83,135,296 M182L probably benign Het
Por T C 5: 135,731,178 S240P possibly damaging Het
Pramef20 A T 4: 144,377,273 probably benign Het
Prss22 A T 17: 23,996,301 V167D probably damaging Het
Prss37 A C 6: 40,516,349 L61R probably damaging Het
Psmd1 C T 1: 86,118,616 T702M probably benign Het
Pxdn G T 12: 30,002,431 G869V possibly damaging Het
Rabgap1l A G 1: 160,453,745 probably benign Het
Rapgef6 T C 11: 54,619,941 V228A probably damaging Het
Rnf169 T C 7: 99,926,003 R462G possibly damaging Het
Rnft2 A G 5: 118,194,680 probably benign Het
Sh3bgr T C 16: 96,228,517 probably benign Het
Slc12a4 A G 8: 105,945,350 V910A possibly damaging Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Spty2d1 G A 7: 46,997,901 R427* probably null Het
Ssc5d A G 7: 4,944,663 T1339A probably benign Het
Sspo A C 6: 48,455,752 E854A possibly damaging Het
Stx7 A G 10: 24,185,079 probably benign Het
Styk1 A T 6: 131,301,730 probably benign Het
Tex33 T A 15: 78,378,828 M209L probably damaging Het
Tmem163 T G 1: 127,668,637 probably benign Het
Tmppe C CT 9: 114,404,639 probably null Het
Tmx2 A G 2: 84,673,082 V229A probably benign Het
Top2b T C 14: 16,383,174 L54P probably damaging Het
Trim62 A T 4: 128,902,550 Y280F probably benign Het
Tssk4 A T 14: 55,651,559 K181* probably null Het
Tssk4 A T 14: 55,651,560 K181M probably damaging Het
Ubn1 A G 16: 5,064,614 D313G probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Other mutations in Sgo2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sgo2b APN 8 63926523 missense probably benign
IGL01343:Sgo2b APN 8 63927315 nonsense probably null
IGL02027:Sgo2b APN 8 63926829 missense probably benign
IGL02090:Sgo2b APN 8 63927089 missense probably damaging 0.99
IGL02121:Sgo2b APN 8 63931282 missense possibly damaging 0.94
IGL02206:Sgo2b APN 8 63941084 missense possibly damaging 0.94
IGL02554:Sgo2b APN 8 63926537 missense probably damaging 0.96
IGL02663:Sgo2b APN 8 63943114 missense probably damaging 0.97
IGL03149:Sgo2b APN 8 63926583 missense probably benign 0.14
floater UTSW 8 63938417 nonsense probably null
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0285:Sgo2b UTSW 8 63928789 nonsense probably null
R0325:Sgo2b UTSW 8 63928376 missense probably benign 0.20
R0727:Sgo2b UTSW 8 63927782 missense probably damaging 0.98
R0943:Sgo2b UTSW 8 63931335 missense possibly damaging 0.82
R1148:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1266:Sgo2b UTSW 8 63928421 missense probably benign 0.00
R1484:Sgo2b UTSW 8 63931473 missense possibly damaging 0.77
R1493:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1537:Sgo2b UTSW 8 63926502 missense possibly damaging 0.94
R1630:Sgo2b UTSW 8 63927797 missense possibly damaging 0.90
R1803:Sgo2b UTSW 8 63927392 missense probably benign 0.01
R1912:Sgo2b UTSW 8 63931469 missense probably damaging 0.98
R1993:Sgo2b UTSW 8 63926833 missense probably benign 0.36
R2042:Sgo2b UTSW 8 63928527 missense probably benign
R2130:Sgo2b UTSW 8 63927147 missense probably benign 0.09
R2146:Sgo2b UTSW 8 63928023 missense probably benign 0.00
R2881:Sgo2b UTSW 8 63927536 missense probably damaging 0.99
R3686:Sgo2b UTSW 8 63931327 missense probably benign 0.20
R3706:Sgo2b UTSW 8 63928145 missense probably damaging 0.98
R3889:Sgo2b UTSW 8 63927743 missense possibly damaging 0.82
R3894:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R3895:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R4058:Sgo2b UTSW 8 63926947 missense probably damaging 0.98
R4259:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4260:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4704:Sgo2b UTSW 8 63927790 missense probably damaging 0.98
R4815:Sgo2b UTSW 8 63931414 missense probably benign
R4922:Sgo2b UTSW 8 63926630 missense possibly damaging 0.66
R5232:Sgo2b UTSW 8 63928602 missense possibly damaging 0.55
R5262:Sgo2b UTSW 8 63943137 missense probably damaging 0.99
R5444:Sgo2b UTSW 8 63926556 missense possibly damaging 0.90
R5677:Sgo2b UTSW 8 63926974 missense possibly damaging 0.77
R5959:Sgo2b UTSW 8 63927288 missense probably benign 0.01
R6004:Sgo2b UTSW 8 63926673 nonsense probably null
R6267:Sgo2b UTSW 8 63927793 missense probably benign
R6296:Sgo2b UTSW 8 63927793 missense probably benign
R6328:Sgo2b UTSW 8 63928311 nonsense probably null
R6517:Sgo2b UTSW 8 63931494 missense probably damaging 0.99
R6523:Sgo2b UTSW 8 63927504 missense probably benign 0.11
R6726:Sgo2b UTSW 8 63927735 nonsense probably null
R6957:Sgo2b UTSW 8 63931455 small deletion probably benign
R7031:Sgo2b UTSW 8 63940044 missense possibly damaging 0.94
R7034:Sgo2b UTSW 8 63926834 missense probably benign 0.36
R7145:Sgo2b UTSW 8 63928184 missense probably damaging 1.00
R7289:Sgo2b UTSW 8 63941158 missense probably damaging 0.97
R7366:Sgo2b UTSW 8 63938417 nonsense probably null
R7660:Sgo2b UTSW 8 63940074 missense probably benign 0.27
R7761:Sgo2b UTSW 8 63926912 missense probably benign
R7762:Sgo2b UTSW 8 63926497 missense probably benign 0.03
R7822:Sgo2b UTSW 8 63927284 missense probably damaging 0.98
RF014:Sgo2b UTSW 8 63931405 missense possibly damaging 0.94
RF055:Sgo2b UTSW 8 63943169 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63927005 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63928422 missense possibly damaging 0.61
Z1177:Sgo2b UTSW 8 63927439 missense probably benign 0.03
Z1177:Sgo2b UTSW 8 63928385 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATATAAGCTGCTGGACTGAGCCCC -3'
(R):5'- GTTGACTCCCAACAGACTGAGAAGG -3'

Sequencing Primer
(F):5'- CTAAAACTCTGGCCTACCTGG -3'
(R):5'- CAGACTGAGAAGGAGAACTATTTGG -3'
Posted On2013-04-16