Incidental Mutation 'R0201:Cbln1'
ID23643
Institutional Source Beutler Lab
Gene Symbol Cbln1
Ensembl Gene ENSMUSG00000031654
Gene Namecerebellin 1 precursor protein
Synonyms
MMRRC Submission 038458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R0201 (G1)
Quality Score191
Status Validated
Chromosome8
Chromosomal Location87468405-87472609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87472113 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 43 (T43K)
Ref Sequence ENSEMBL: ENSMUSP00000126575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034076] [ENSMUST00000169693]
Predicted Effect probably benign
Transcript: ENSMUST00000034076
AA Change: T43K

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034076
Gene: ENSMUSG00000031654
AA Change: T43K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
C1Q 55 193 6.52e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169693
AA Change: T43K

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126575
Gene: ENSMUSG00000031654
AA Change: T43K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
C1Q 55 193 6.52e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211631
Meta Mutation Damage Score 0.0880 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cerebellum-specific precursor protein, precerebellin, with similarity to the globular (non-collagen-like) domain of complement component C1qB. Precerebellin is processed to give rise to several derivatives, including the hexadecapeptide, cerebellin, which is highly enriched in postsynaptic structures of Purkinje cells. Cerebellin has also been found in human and rat adrenals, where it has been shown to enhance the secretory activity of this gland. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous mutation of this gene results in ataxia, impaired coordination, and abnormal Purkinje cell excitatory postsynaptic currents and innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,581,957 probably null Het
Adamts16 T A 13: 70,779,644 Q492L possibly damaging Het
Aplnr A G 2: 85,137,177 D182G probably damaging Het
Arnt2 G T 7: 84,361,659 S3* probably null Het
Asxl3 T C 18: 22,523,154 V1407A probably benign Het
Atg13 A T 2: 91,684,762 probably null Het
Atm A T 9: 53,454,279 probably benign Het
Birc6 T G 17: 74,609,327 V1746G possibly damaging Het
Cbx5 T C 15: 103,199,700 T173A probably damaging Het
Cc2d2a A G 5: 43,737,512 Y1437C probably damaging Het
Ccdc78 C A 17: 25,789,236 probably benign Het
Cd2bp2 A G 7: 127,193,828 Y341H probably damaging Het
Cdhr5 T A 7: 141,276,378 D88V probably damaging Het
Ces1f T A 8: 93,267,329 T275S probably null Het
Clca4a T C 3: 144,960,717 N458S probably benign Het
Cog5 A G 12: 31,839,841 K521R probably damaging Het
Csf2ra T A 19: 61,225,568 T305S probably benign Het
Csmd3 T A 15: 47,619,729 probably benign Het
Cts6 T A 13: 61,201,499 R132* probably null Het
D5Ertd579e G T 5: 36,616,465 N195K probably damaging Het
Ddx1 A G 12: 13,223,808 V606A probably damaging Het
Dip2b G A 15: 100,186,147 D884N probably damaging Het
Ehhadh A G 16: 21,773,493 probably null Het
Enpp1 T A 10: 24,653,917 T608S probably benign Het
Fancm T C 12: 65,101,632 Y674H probably damaging Het
Fat4 T A 3: 38,891,596 V1546D probably damaging Het
Fsd1 G A 17: 55,990,522 A158T probably benign Het
Fzd2 T A 11: 102,606,122 M464K probably damaging Het
Gjc2 A G 11: 59,177,590 F22S possibly damaging Het
Gm13101 T C 4: 143,964,890 E421G probably damaging Het
Gria2 T C 3: 80,707,838 Y445C probably damaging Het
Hsdl1 T A 8: 119,566,256 I147F possibly damaging Het
Ifi44 T C 3: 151,745,636 Y226C probably damaging Het
Il16 A G 7: 83,722,308 C97R probably damaging Het
Impg1 A T 9: 80,345,561 S369T probably damaging Het
Jmjd1c A G 10: 67,219,109 T390A unknown Het
Lgi1 A G 19: 38,301,293 E269G possibly damaging Het
Lrp6 G T 6: 134,450,897 Y1577* probably null Het
Lrrc74a G T 12: 86,761,773 probably benign Het
Man1c1 A T 4: 134,640,398 probably null Het
Map1lc3b A C 8: 121,590,550 Q9P possibly damaging Het
Mboat1 G A 13: 30,202,375 R124H probably benign Het
Mcu A G 10: 59,456,677 L60P probably damaging Het
Mrs2 G T 13: 25,018,534 Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Neb G A 2: 52,206,878 probably benign Het
Nlrp2 C T 7: 5,328,329 G356D probably benign Het
Notch3 A G 17: 32,156,148 probably benign Het
Npr2 A C 4: 43,641,617 S474R probably damaging Het
Nupl1 A G 14: 60,244,616 F100L probably benign Het
Osbpl6 A C 2: 76,546,042 D87A possibly damaging Het
Pabpc2 A T 18: 39,775,307 M542L probably benign Het
Papln A G 12: 83,783,027 probably benign Het
Parpbp T C 10: 88,092,896 I561V possibly damaging Het
Pcdhb13 C T 18: 37,442,581 A4V probably benign Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Poldip3 T A 15: 83,135,296 M182L probably benign Het
Por T C 5: 135,731,178 S240P possibly damaging Het
Pramef20 A T 4: 144,377,273 probably benign Het
Prss22 A T 17: 23,996,301 V167D probably damaging Het
Prss37 A C 6: 40,516,349 L61R probably damaging Het
Psmd1 C T 1: 86,118,616 T702M probably benign Het
Pxdn G T 12: 30,002,431 G869V possibly damaging Het
Rabgap1l A G 1: 160,453,745 probably benign Het
Rapgef6 T C 11: 54,619,941 V228A probably damaging Het
Rnf169 T C 7: 99,926,003 R462G possibly damaging Het
Rnft2 A G 5: 118,194,680 probably benign Het
Sgo2b T C 8: 63,926,636 D1054G probably benign Het
Sh3bgr T C 16: 96,228,517 probably benign Het
Slc12a4 A G 8: 105,945,350 V910A possibly damaging Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Spty2d1 G A 7: 46,997,901 R427* probably null Het
Ssc5d A G 7: 4,944,663 T1339A probably benign Het
Sspo A C 6: 48,455,752 E854A possibly damaging Het
Stx7 A G 10: 24,185,079 probably benign Het
Styk1 A T 6: 131,301,730 probably benign Het
Tex33 T A 15: 78,378,828 M209L probably damaging Het
Tmem163 T G 1: 127,668,637 probably benign Het
Tmppe C CT 9: 114,404,639 probably null Het
Tmx2 A G 2: 84,673,082 V229A probably benign Het
Top2b T C 14: 16,383,174 L54P probably damaging Het
Trim62 A T 4: 128,902,550 Y280F probably benign Het
Tssk4 A T 14: 55,651,559 K181* probably null Het
Tssk4 A T 14: 55,651,560 K181M probably damaging Het
Ubn1 A G 16: 5,064,614 D313G probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Other mutations in Cbln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5496:Cbln1 UTSW 8 87471696 missense possibly damaging 0.73
R6786:Cbln1 UTSW 8 87472029 missense probably benign 0.30
R7561:Cbln1 UTSW 8 87471996 missense probably benign 0.00
R7638:Cbln1 UTSW 8 87471729 missense probably damaging 1.00
R7848:Cbln1 UTSW 8 87471700 missense probably damaging 1.00
R7908:Cbln1 UTSW 8 87472096 missense probably benign 0.00
R7931:Cbln1 UTSW 8 87471700 missense probably damaging 1.00
R7989:Cbln1 UTSW 8 87472096 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGGGGAACTCACCTGGTCGAAG -3'
(R):5'- ATCAATAATTCAGAGCGGCGGCGG -3'

Sequencing Primer
(F):5'- CTCACCTGGTCGAAGTAGATG -3'
(R):5'- gggaccaggcagcagag -3'
Posted On2013-04-16