Incidental Mutation 'R2143:Ash1l'
ID236463
Institutional Source Beutler Lab
Gene Symbol Ash1l
Ensembl Gene ENSMUSG00000028053
Gene NameASH1 like histone lysine methyltransferase
Synonymschromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
MMRRC Submission 040146-MU
Accession Numbers

Genbank: NM_138679; MGI: 2183158

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2143 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88950622-89079375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88985419 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1535 (M1535K)
Ref Sequence ENSEMBL: ENSMUSP00000140251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]
Predicted Effect probably benign
Transcript: ENSMUST00000090933
AA Change: M1535K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: M1535K

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186583
AA Change: M1535K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: M1535K

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G C 16: 88,759,165 S89T probably benign Het
4930522L14Rik C G 5: 109,736,750 C414S probably damaging Het
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Apobr G A 7: 126,587,116 E600K probably benign Het
Armc8 C A 9: 99,505,308 R419L probably damaging Het
Atf7ip2 A G 16: 10,240,645 E316G probably null Het
Atp2a1 G A 7: 126,448,725 R638* probably null Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Atp8b4 A T 2: 126,374,510 I672N probably damaging Het
Atrn T C 2: 130,957,996 V431A probably benign Het
Babam1 T C 8: 71,398,440 S116P probably damaging Het
Ccdc142 T C 6: 83,102,222 L180P probably damaging Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdk17 T C 10: 93,218,019 L125P probably damaging Het
Ckap5 A G 2: 91,565,745 D531G probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Crispld1 C T 1: 17,749,636 T286I probably benign Het
Crtap T C 9: 114,379,968 Y336C probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dsg2 T A 18: 20,579,161 I118N probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Elmo3 T C 8: 105,308,673 V450A probably damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Enam T A 5: 88,492,920 M147K probably benign Het
Entpd1 T C 19: 40,736,783 Y409H probably damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fbn2 A G 18: 58,052,993 V1761A possibly damaging Het
Fsip2 A T 2: 82,990,271 L5449F possibly damaging Het
Gabra5 G A 7: 57,489,015 T95I probably damaging Het
Gal3st2c C T 1: 94,009,451 Q373* probably null Het
Gbp5 A C 3: 142,503,832 T180P probably damaging Het
Glb1 T C 9: 114,437,824 L212P probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gpat2 T C 2: 127,433,762 F487L probably damaging Het
Hsph1 A T 5: 149,631,486 H110Q probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Ildr2 T C 1: 166,269,326 V38A probably damaging Het
Inpp4a G T 1: 37,387,746 C326F probably damaging Het
Irak2 T A 6: 113,672,827 V141D probably benign Het
Jade1 G A 3: 41,604,708 R408Q probably benign Het
Jmjd7 C A 2: 120,030,120 probably null Het
Kdm7a C T 6: 39,168,950 V348I possibly damaging Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krt5 A G 15: 101,712,359 I151T probably damaging Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc71 C T 3: 87,745,521 W148* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a T A 2: 121,301,945 S843T probably damaging Het
Map1s T A 8: 70,910,964 D48E probably damaging Het
Mast4 A G 13: 102,735,475 F2462L possibly damaging Het
Mettl21e T A 1: 44,210,238 Y86F probably benign Het
Myh6 A T 14: 54,952,954 D1035E probably damaging Het
Naip6 C T 13: 100,299,859 D719N probably damaging Het
Nat8f2 T G 6: 85,868,257 H41P probably benign Het
Ncam1 T A 9: 49,543,019 Q597L possibly damaging Het
Nek1 T A 8: 61,028,696 I215K probably damaging Het
Nol11 A T 11: 107,181,055 S237R probably benign Het
Npr2 T C 4: 43,648,166 F870S probably damaging Het
Nsd1 T C 13: 55,260,397 Y1285H probably damaging Het
Nup93 C T 8: 94,296,480 Q229* probably null Het
Olfr1234 C T 2: 89,363,103 E109K probably damaging Het
Olfr834 G A 9: 18,988,803 A272T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Parva A G 7: 112,560,067 D180G possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pax1 T A 2: 147,365,882 C225S probably damaging Het
Pde4dip T A 3: 97,888,519 E51V possibly damaging Het
Pde6c A T 19: 38,162,329 H562L probably damaging Het
Pet100 T G 8: 3,622,355 L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Polr2d T A 18: 31,796,079 L127Q probably damaging Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Psd3 T C 8: 67,964,351 D45G probably damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptpn6 T A 6: 124,724,984 H406L probably benign Het
Ric1 A T 19: 29,533,252 S78C probably damaging Het
Ric1 G A 19: 29,533,253 S78N probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Senp7 A G 16: 56,169,806 H639R probably benign Het
Sgtb A T 13: 104,124,259 D72V probably damaging Het
Slc44a5 T C 3: 154,258,449 M484T probably benign Het
Slc5a1 A G 5: 33,160,796 K598E probably benign Het
Slit3 T A 11: 35,612,261 probably null Het
Smc1b T C 15: 85,123,802 H258R probably benign Het
Smu1 T C 4: 40,744,073 D318G probably damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Svs3a C A 2: 164,289,884 S124Y probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tdpoz1 T A 3: 93,670,836 R214* probably null Het
Tm2d3 A G 7: 65,695,239 D54G probably damaging Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Triml2 T A 8: 43,193,511 W346R probably damaging Het
Trp53bp1 A T 2: 121,216,064 V1085D probably benign Het
Trpv2 T C 11: 62,592,786 V483A probably benign Het
Ugp2 G T 11: 21,328,949 N412K probably benign Het
Upf1 T C 8: 70,339,354 D418G probably null Het
Vmn2r77 C A 7: 86,811,944 P826Q probably damaging Het
Vrtn T C 12: 84,650,162 M562T probably benign Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Zdhhc6 T C 19: 55,298,796 K411E probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp280d A G 9: 72,312,729 N237S probably damaging Het
Zfp445 T G 9: 122,853,482 S465R possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Other mutations in Ash1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ash1l APN 3 88981712 missense probably benign 0.19
IGL00819:Ash1l APN 3 89007736 missense possibly damaging 0.68
IGL00939:Ash1l APN 3 89035236 missense probably damaging 0.99
IGL01064:Ash1l APN 3 89072484 missense probably damaging 1.00
IGL01066:Ash1l APN 3 88984635 missense probably damaging 1.00
IGL01087:Ash1l APN 3 89063902 missense probably damaging 1.00
IGL01293:Ash1l APN 3 88983529 missense probably benign 0.01
IGL01541:Ash1l APN 3 89066265 missense probably damaging 1.00
IGL01863:Ash1l APN 3 88985506 nonsense probably null
IGL02326:Ash1l APN 3 88966057 missense probably benign 0.00
IGL02407:Ash1l APN 3 89072548 missense probably damaging 1.00
IGL02419:Ash1l APN 3 88985565 missense probably benign 0.00
IGL02422:Ash1l APN 3 89069079 critical splice donor site probably null
IGL02494:Ash1l APN 3 89066218 nonsense probably null
IGL02727:Ash1l APN 3 89023037 missense probably benign
IGL02732:Ash1l APN 3 88966228 missense probably damaging 1.00
IGL02817:Ash1l APN 3 88984801 missense probably damaging 1.00
IGL02887:Ash1l APN 3 88984181 missense probably benign 0.11
IGL03224:Ash1l APN 3 89035268 splice site probably benign
IGL03253:Ash1l APN 3 88984674 missense probably damaging 1.00
IGL03327:Ash1l APN 3 89023083 missense probably benign 0.02
IGL03398:Ash1l APN 3 89007220 missense probably benign 0.01
3-1:Ash1l UTSW 3 88966326 missense probably benign
BB008:Ash1l UTSW 3 89043541 missense probably damaging 1.00
BB018:Ash1l UTSW 3 89043541 missense probably damaging 1.00
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0395:Ash1l UTSW 3 89058589 missense probably damaging 1.00
R0477:Ash1l UTSW 3 88983459 missense probably benign 0.41
R0528:Ash1l UTSW 3 88982277 missense probably benign
R0543:Ash1l UTSW 3 89063778 splice site probably null
R0855:Ash1l UTSW 3 89054454 missense possibly damaging 0.82
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1163:Ash1l UTSW 3 89035263 critical splice donor site probably null
R1196:Ash1l UTSW 3 88983316 missense probably damaging 0.99
R1419:Ash1l UTSW 3 88984897 missense probably damaging 0.99
R1445:Ash1l UTSW 3 89007352 missense probably benign 0.02
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1480:Ash1l UTSW 3 88985052 missense probably damaging 1.00
R1506:Ash1l UTSW 3 89058499 missense probably damaging 0.99
R1537:Ash1l UTSW 3 89072476 missense probably damaging 0.99
R1584:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1669:Ash1l UTSW 3 89067242 critical splice donor site probably null
R1713:Ash1l UTSW 3 89076224 missense probably damaging 1.00
R1780:Ash1l UTSW 3 88965984 missense probably benign
R1793:Ash1l UTSW 3 89070309 missense probably damaging 1.00
R1881:Ash1l UTSW 3 88981555 missense probably benign 0.00
R1909:Ash1l UTSW 3 88984528 missense probably benign 0.29
R1938:Ash1l UTSW 3 88984422 missense probably damaging 0.98
R2035:Ash1l UTSW 3 89066317 missense probably benign 0.00
R2070:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2071:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2114:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2116:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2118:Ash1l UTSW 3 88985295 missense possibly damaging 0.80
R2164:Ash1l UTSW 3 88985419 missense probably benign 0.09
R2210:Ash1l UTSW 3 89066298 missense probably damaging 1.00
R2247:Ash1l UTSW 3 89007367 missense possibly damaging 0.77
R2303:Ash1l UTSW 3 89026426 missense probably damaging 1.00
R2860:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R2861:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R3104:Ash1l UTSW 3 89054386 missense probably damaging 1.00
R4133:Ash1l UTSW 3 88982260 missense probably benign 0.00
R4164:Ash1l UTSW 3 88981966 missense probably damaging 0.97
R4270:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4271:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4287:Ash1l UTSW 3 89066415 missense probably damaging 0.99
R4409:Ash1l UTSW 3 89007199 missense probably damaging 0.99
R4459:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R4487:Ash1l UTSW 3 88985315 missense possibly damaging 0.65
R4674:Ash1l UTSW 3 89072476 missense possibly damaging 0.80
R4739:Ash1l UTSW 3 88982845 missense probably benign 0.19
R4927:Ash1l UTSW 3 88985334 missense probably damaging 1.00
R5000:Ash1l UTSW 3 89058634 missense probably damaging 1.00
R5016:Ash1l UTSW 3 88982323 missense probably damaging 1.00
R5055:Ash1l UTSW 3 89023212 critical splice donor site probably null
R5081:Ash1l UTSW 3 88984717 missense probably damaging 1.00
R5082:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R5090:Ash1l UTSW 3 89052877 missense probably damaging 1.00
R5113:Ash1l UTSW 3 89066275 missense probably damaging 0.99
R5408:Ash1l UTSW 3 88982394 missense probably damaging 1.00
R5452:Ash1l UTSW 3 88984876 missense possibly damaging 0.93
R5487:Ash1l UTSW 3 88981426 missense probably benign 0.17
R5610:Ash1l UTSW 3 89023185 missense probably damaging 1.00
R5624:Ash1l UTSW 3 88985609 missense probably damaging 1.00
R5682:Ash1l UTSW 3 89007607 missense probably damaging 0.99
R5712:Ash1l UTSW 3 89051990 missense probably damaging 0.99
R5719:Ash1l UTSW 3 89054498 missense possibly damaging 0.83
R5719:Ash1l UTSW 3 89058626 missense probably damaging 1.00
R5839:Ash1l UTSW 3 88983351 missense probably damaging 0.99
R5859:Ash1l UTSW 3 89068993 missense probably damaging 1.00
R5877:Ash1l UTSW 3 88981584 missense probably benign 0.00
R5940:Ash1l UTSW 3 88984036 missense probably damaging 0.96
R6026:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6027:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6029:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6089:Ash1l UTSW 3 89053143 nonsense probably null
R6110:Ash1l UTSW 3 88985129 missense probably damaging 1.00
R6168:Ash1l UTSW 3 89052773 nonsense probably null
R6200:Ash1l UTSW 3 89070527 missense probably damaging 1.00
R6290:Ash1l UTSW 3 88982761 nonsense probably null
R6331:Ash1l UTSW 3 89007865 missense probably benign 0.00
R6425:Ash1l UTSW 3 88983780 missense probably damaging 0.99
R6540:Ash1l UTSW 3 88985061 missense probably damaging 1.00
R6568:Ash1l UTSW 3 89052037 missense probably benign 0.09
R6828:Ash1l UTSW 3 89076113 missense probably benign 0.00
R6843:Ash1l UTSW 3 88985388 missense probably damaging 1.00
R6894:Ash1l UTSW 3 88982991 missense probably benign 0.00
R6976:Ash1l UTSW 3 88981657 missense possibly damaging 0.77
R7038:Ash1l UTSW 3 88982671 missense probably benign 0.00
R7073:Ash1l UTSW 3 88985340 missense probably damaging 1.00
R7133:Ash1l UTSW 3 88983457 frame shift probably null
R7150:Ash1l UTSW 3 89077074 missense probably damaging 1.00
R7205:Ash1l UTSW 3 88965952 missense probably benign 0.00
R7254:Ash1l UTSW 3 89070509 missense probably damaging 1.00
R7272:Ash1l UTSW 3 89054634 intron probably null
R7288:Ash1l UTSW 3 88965892 start gained probably benign
R7319:Ash1l UTSW 3 88981387 missense probably benign 0.19
R7341:Ash1l UTSW 3 88981759 missense possibly damaging 0.93
R7342:Ash1l UTSW 3 88965997 missense possibly damaging 0.94
R7454:Ash1l UTSW 3 88983865 missense probably benign 0.16
R7677:Ash1l UTSW 3 89043193 missense probably damaging 1.00
R7822:Ash1l UTSW 3 89007264 missense probably benign
R7857:Ash1l UTSW 3 88984309 nonsense probably null
R7889:Ash1l UTSW 3 88966038 missense probably benign 0.00
R7898:Ash1l UTSW 3 88983625 missense possibly damaging 0.54
R7931:Ash1l UTSW 3 89043541 missense probably damaging 1.00
R8119:Ash1l UTSW 3 89035427 missense probably damaging 1.00
R8157:Ash1l UTSW 3 89063707 critical splice donor site probably null
R8162:Ash1l UTSW 3 89070246 missense probably damaging 0.99
R8194:Ash1l UTSW 3 89052755 missense probably damaging 1.00
R8306:Ash1l UTSW 3 88965952 missense probably benign 0.00
X0017:Ash1l UTSW 3 88984585 missense probably benign 0.45
X0019:Ash1l UTSW 3 89070556 missense probably damaging 1.00
X0021:Ash1l UTSW 3 88983204 missense probably benign 0.10
Z1088:Ash1l UTSW 3 88982709 missense probably benign 0.00
Z1176:Ash1l UTSW 3 89043217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTCCAGAGATGGCTTATGG -3'
(R):5'- TGTTCATCACTGCTGGCTGG -3'

Sequencing Primer
(F):5'- TTGGATGGTGGAGCACAAACAC -3'
(R):5'- CTGGCTCAGAATTGGGAGTAAATCC -3'
Posted On2014-10-01