Incidental Mutation 'R2143:Pet100'
ID236503
Institutional Source Beutler Lab
Gene Symbol Pet100
Ensembl Gene ENSMUSG00000087687
Gene NamePET100 homolog
Synonyms
MMRRC Submission 040146-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R2143 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3621548-3625848 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3622355 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 14 (L14R)
Ref Sequence ENSEMBL: ENSMUSP00000146433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004749] [ENSMUST00000019614] [ENSMUST00000128566] [ENSMUST00000133459] [ENSMUST00000136105] [ENSMUST00000142431] [ENSMUST00000144977] [ENSMUST00000156380] [ENSMUST00000159235] [ENSMUST00000207389] [ENSMUST00000207428] [ENSMUST00000208950]
Predicted Effect probably benign
Transcript: ENSMUST00000004749
SMART Domains Protein: ENSMUSP00000004749
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 26 48 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019614
SMART Domains Protein: ENSMUSP00000019614
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
HAT 48 80 7.56e0 SMART
HAT 93 122 1.92e2 SMART
HAT 124 158 4.89e-2 SMART
HAT 270 305 3.82e-4 SMART
low complexity region 316 333 N/A INTRINSIC
HAT 409 445 1.88e1 SMART
HAT 447 496 2.32e2 SMART
HAT 498 530 1.56e1 SMART
HAT 532 566 5.84e0 SMART
HAT 571 605 3.62e-5 SMART
Blast:HAT 607 641 3e-14 BLAST
Blast:HAT 643 677 2e-15 BLAST
HAT 679 713 2.77e-1 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 823 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128566
Predicted Effect probably benign
Transcript: ENSMUST00000133459
SMART Domains Protein: ENSMUSP00000122902
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 7 29 3.29e-6 SMART
GoLoco 47 69 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136105
SMART Domains Protein: ENSMUSP00000121079
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 23 45 3.29e-6 SMART
GoLoco 63 85 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142431
SMART Domains Protein: ENSMUSP00000121403
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 26 48 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145855
Predicted Effect probably damaging
Transcript: ENSMUST00000156380
AA Change: L14R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137626
Gene: ENSMUSG00000087687
AA Change: L14R

DomainStartEndE-ValueType
Pfam:DUF2346 1 72 2.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159235
SMART Domains Protein: ENSMUSP00000124237
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 12 47 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159548
SMART Domains Protein: ENSMUSP00000124202
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 10 44 4e-12 BLAST
HAT 46 78 7.56e0 SMART
HAT 91 120 1.92e2 SMART
HAT 122 156 4.89e-2 SMART
Blast:HAT 157 190 4e-12 BLAST
Pfam:TPR_2 243 272 2.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207257
Predicted Effect probably damaging
Transcript: ENSMUST00000207389
AA Change: L5R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207428
AA Change: L10R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208185
Predicted Effect probably damaging
Transcript: ENSMUST00000208950
AA Change: L14R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial complex IV, or cytochrome c oxidase, is a large transmembrane protein complex that is part of the respiratory electron transport chain of mitochondria. The small protein encoded by this gene plays a role in the biogenesis of mitochondrial complex IV. This protein localizes to the inner mitochondrial membrane and is exposed to the intermembrane space. Mutations in this gene are associated with mitochondrial complex IV deficiency. This gene has a pseudogene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G C 16: 88,759,165 S89T probably benign Het
4930522L14Rik C G 5: 109,736,750 C414S probably damaging Het
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Apobr G A 7: 126,587,116 E600K probably benign Het
Armc8 C A 9: 99,505,308 R419L probably damaging Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf7ip2 A G 16: 10,240,645 E316G probably null Het
Atp2a1 G A 7: 126,448,725 R638* probably null Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Atp8b4 A T 2: 126,374,510 I672N probably damaging Het
Atrn T C 2: 130,957,996 V431A probably benign Het
Babam1 T C 8: 71,398,440 S116P probably damaging Het
Ccdc142 T C 6: 83,102,222 L180P probably damaging Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdk17 T C 10: 93,218,019 L125P probably damaging Het
Ckap5 A G 2: 91,565,745 D531G probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Crispld1 C T 1: 17,749,636 T286I probably benign Het
Crtap T C 9: 114,379,968 Y336C probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dsg2 T A 18: 20,579,161 I118N probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Elmo3 T C 8: 105,308,673 V450A probably damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Enam T A 5: 88,492,920 M147K probably benign Het
Entpd1 T C 19: 40,736,783 Y409H probably damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fbn2 A G 18: 58,052,993 V1761A possibly damaging Het
Fsip2 A T 2: 82,990,271 L5449F possibly damaging Het
Gabra5 G A 7: 57,489,015 T95I probably damaging Het
Gal3st2c C T 1: 94,009,451 Q373* probably null Het
Gbp5 A C 3: 142,503,832 T180P probably damaging Het
Glb1 T C 9: 114,437,824 L212P probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gpat2 T C 2: 127,433,762 F487L probably damaging Het
Hsph1 A T 5: 149,631,486 H110Q probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Ildr2 T C 1: 166,269,326 V38A probably damaging Het
Inpp4a G T 1: 37,387,746 C326F probably damaging Het
Irak2 T A 6: 113,672,827 V141D probably benign Het
Jade1 G A 3: 41,604,708 R408Q probably benign Het
Jmjd7 C A 2: 120,030,120 probably null Het
Kdm7a C T 6: 39,168,950 V348I possibly damaging Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krt5 A G 15: 101,712,359 I151T probably damaging Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc71 C T 3: 87,745,521 W148* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a T A 2: 121,301,945 S843T probably damaging Het
Map1s T A 8: 70,910,964 D48E probably damaging Het
Mast4 A G 13: 102,735,475 F2462L possibly damaging Het
Mettl21e T A 1: 44,210,238 Y86F probably benign Het
Myh6 A T 14: 54,952,954 D1035E probably damaging Het
Naip6 C T 13: 100,299,859 D719N probably damaging Het
Nat8f2 T G 6: 85,868,257 H41P probably benign Het
Ncam1 T A 9: 49,543,019 Q597L possibly damaging Het
Nek1 T A 8: 61,028,696 I215K probably damaging Het
Nol11 A T 11: 107,181,055 S237R probably benign Het
Npr2 T C 4: 43,648,166 F870S probably damaging Het
Nsd1 T C 13: 55,260,397 Y1285H probably damaging Het
Nup93 C T 8: 94,296,480 Q229* probably null Het
Olfr1234 C T 2: 89,363,103 E109K probably damaging Het
Olfr834 G A 9: 18,988,803 A272T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Parva A G 7: 112,560,067 D180G possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pax1 T A 2: 147,365,882 C225S probably damaging Het
Pde4dip T A 3: 97,888,519 E51V possibly damaging Het
Pde6c A T 19: 38,162,329 H562L probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Polr2d T A 18: 31,796,079 L127Q probably damaging Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Psd3 T C 8: 67,964,351 D45G probably damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptpn6 T A 6: 124,724,984 H406L probably benign Het
Ric1 A T 19: 29,533,252 S78C probably damaging Het
Ric1 G A 19: 29,533,253 S78N probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Senp7 A G 16: 56,169,806 H639R probably benign Het
Sgtb A T 13: 104,124,259 D72V probably damaging Het
Slc44a5 T C 3: 154,258,449 M484T probably benign Het
Slc5a1 A G 5: 33,160,796 K598E probably benign Het
Slit3 T A 11: 35,612,261 probably null Het
Smc1b T C 15: 85,123,802 H258R probably benign Het
Smu1 T C 4: 40,744,073 D318G probably damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Svs3a C A 2: 164,289,884 S124Y probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tdpoz1 T A 3: 93,670,836 R214* probably null Het
Tm2d3 A G 7: 65,695,239 D54G probably damaging Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Triml2 T A 8: 43,193,511 W346R probably damaging Het
Trp53bp1 A T 2: 121,216,064 V1085D probably benign Het
Trpv2 T C 11: 62,592,786 V483A probably benign Het
Ugp2 G T 11: 21,328,949 N412K probably benign Het
Upf1 T C 8: 70,339,354 D418G probably null Het
Vmn2r77 C A 7: 86,811,944 P826Q probably damaging Het
Vrtn T C 12: 84,650,162 M562T probably benign Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Zdhhc6 T C 19: 55,298,796 K411E probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp280d A G 9: 72,312,729 N237S probably damaging Het
Zfp445 T G 9: 122,853,482 S465R possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Other mutations in Pet100
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2144:Pet100 UTSW 8 3622355 missense probably damaging 1.00
R5554:Pet100 UTSW 8 3622381 missense probably damaging 1.00
R6120:Pet100 UTSW 8 3621764 intron probably null
R6377:Pet100 UTSW 8 3622370 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTGGACAGAACTACTACGAG -3'
(R):5'- CTGTGGAACAAAGTCACAGGTG -3'

Sequencing Primer
(F):5'- TGGACAGAACTACTACGAGTAAAATC -3'
(R):5'- TCCACAACAGGGTTGACTCATGAG -3'
Posted On2014-10-01