Incidental Mutation 'R2143:Upf1'
ID 236507
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, Rent1, PNORF-1
MMRRC Submission 040146-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R2143 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 70784175-70805928 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70792004 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 418 (D418G)
Ref Sequence ENSEMBL: ENSMUSP00000075089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect probably null
Transcript: ENSMUST00000075666
AA Change: D418G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: D418G

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215817
AA Change: D407G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G C 16: 88,556,053 (GRCm39) S89T probably benign Het
4930522L14Rik C G 5: 109,884,616 (GRCm39) C414S probably damaging Het
4930553M12Rik G A 4: 88,786,411 (GRCm39) T69I unknown Het
4930553M12Rik T A 4: 88,786,412 (GRCm39) T69S unknown Het
Apobr G A 7: 126,186,288 (GRCm39) E600K probably benign Het
Armc8 C A 9: 99,387,361 (GRCm39) R419L probably damaging Het
Ash1l T A 3: 88,892,726 (GRCm39) M1535K probably benign Het
Atf7ip2 A G 16: 10,058,509 (GRCm39) E316G probably null Het
Atp2a1 G A 7: 126,047,897 (GRCm39) R638* probably null Het
Atp8b4 A T 2: 126,216,430 (GRCm39) I672N probably damaging Het
Atrn T C 2: 130,799,916 (GRCm39) V431A probably benign Het
Babam1 T C 8: 71,851,084 (GRCm39) S116P probably damaging Het
Ccdc142 T C 6: 83,079,203 (GRCm39) L180P probably damaging Het
Cd52 T C 4: 133,821,048 (GRCm39) probably benign Het
Cdk17 T C 10: 93,053,881 (GRCm39) L125P probably damaging Het
Ckap5 A G 2: 91,396,090 (GRCm39) D531G probably benign Het
Cntn5 G T 9: 9,748,420 (GRCm39) P487Q probably damaging Het
Crispld1 C T 1: 17,819,860 (GRCm39) T286I probably benign Het
Crtap T C 9: 114,209,036 (GRCm39) Y336C probably damaging Het
Ctu2 T A 8: 123,205,891 (GRCm39) I213K probably benign Het
Dmac2l A G 12: 69,787,828 (GRCm39) Q88R probably damaging Het
Dsc3 A G 18: 20,113,743 (GRCm39) F393S possibly damaging Het
Dsg2 T A 18: 20,712,218 (GRCm39) I118N probably damaging Het
Dstyk T A 1: 132,391,113 (GRCm39) M838K probably damaging Het
Elmo3 T C 8: 106,035,305 (GRCm39) V450A probably damaging Het
Eml5 A C 12: 98,776,864 (GRCm39) F1417C probably damaging Het
Enam T A 5: 88,640,779 (GRCm39) M147K probably benign Het
Entpd1 T C 19: 40,725,227 (GRCm39) Y409H probably damaging Het
Extl1 C A 4: 134,098,355 (GRCm39) E225D probably benign Het
Fbn2 A G 18: 58,186,065 (GRCm39) V1761A possibly damaging Het
Fsip2 A T 2: 82,820,615 (GRCm39) L5449F possibly damaging Het
Gabra5 G A 7: 57,138,763 (GRCm39) T95I probably damaging Het
Gal3st2c C T 1: 93,937,173 (GRCm39) Q373* probably null Het
Gbp5 A C 3: 142,209,593 (GRCm39) T180P probably damaging Het
Glb1 T C 9: 114,266,892 (GRCm39) L212P probably damaging Het
Gm11596 A T 11: 99,683,789 (GRCm39) C110* probably null Het
Gpat2 T C 2: 127,275,682 (GRCm39) F487L probably damaging Het
Hsph1 A T 5: 149,554,951 (GRCm39) H110Q probably damaging Het
Ikbke C A 1: 131,201,211 (GRCm39) V176L probably damaging Het
Ildr2 T C 1: 166,096,895 (GRCm39) V38A probably damaging Het
Inpp4a G T 1: 37,426,827 (GRCm39) C326F probably damaging Het
Irak2 T A 6: 113,649,788 (GRCm39) V141D probably benign Het
Jade1 G A 3: 41,559,143 (GRCm39) R408Q probably benign Het
Jmjd7 C A 2: 119,860,601 (GRCm39) probably null Het
Kdm7a C T 6: 39,145,884 (GRCm39) V348I possibly damaging Het
Kif20a A G 18: 34,758,657 (GRCm39) D42G possibly damaging Het
Klhl7 A T 5: 24,305,861 (GRCm39) M37L probably benign Het
Krt5 A G 15: 101,620,794 (GRCm39) I151T probably damaging Het
Krtap1-5 T C 11: 99,471,644 (GRCm39) I50V probably benign Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Lrrc71 C T 3: 87,652,828 (GRCm39) W148* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Map1a T A 2: 121,132,426 (GRCm39) S843T probably damaging Het
Map1s T A 8: 71,363,608 (GRCm39) D48E probably damaging Het
Mast4 A G 13: 102,871,983 (GRCm39) F2462L possibly damaging Het
Mettl21e T A 1: 44,249,398 (GRCm39) Y86F probably benign Het
Myh6 A T 14: 55,190,411 (GRCm39) D1035E probably damaging Het
Naip6 C T 13: 100,436,367 (GRCm39) D719N probably damaging Het
Nat8f2 T G 6: 85,845,239 (GRCm39) H41P probably benign Het
Ncam1 T A 9: 49,454,319 (GRCm39) Q597L possibly damaging Het
Nek1 T A 8: 61,481,730 (GRCm39) I215K probably damaging Het
Nol11 A T 11: 107,071,881 (GRCm39) S237R probably benign Het
Npr2 T C 4: 43,648,166 (GRCm39) F870S probably damaging Het
Nsd1 T C 13: 55,408,210 (GRCm39) Y1285H probably damaging Het
Nup93 C T 8: 95,023,108 (GRCm39) Q229* probably null Het
Or4a15 C T 2: 89,193,447 (GRCm39) E109K probably damaging Het
Or7g12 G A 9: 18,900,099 (GRCm39) A272T probably benign Het
Pappa T A 4: 65,099,186 (GRCm39) Y568* probably null Het
Parva A G 7: 112,159,274 (GRCm39) D180G possibly damaging Het
Pask C T 1: 93,249,019 (GRCm39) A794T probably benign Het
Pax1 T A 2: 147,207,802 (GRCm39) C225S probably damaging Het
Pde4dip T A 3: 97,795,835 (GRCm39) E51V possibly damaging Het
Pde6c A T 19: 38,150,777 (GRCm39) H562L probably damaging Het
Pet100 T G 8: 3,672,355 (GRCm39) L14R probably damaging Het
Pfkfb2 T C 1: 130,626,460 (GRCm39) T438A probably benign Het
Pira2 A T 7: 3,847,344 (GRCm39) L115Q probably damaging Het
Polr2d T A 18: 31,929,132 (GRCm39) L127Q probably damaging Het
Prkd1 A G 12: 50,536,694 (GRCm39) V130A possibly damaging Het
Psd3 T C 8: 68,417,003 (GRCm39) D45G probably damaging Het
Ptpn13 A G 5: 103,703,999 (GRCm39) T1344A probably benign Het
Ptpn6 T A 6: 124,701,947 (GRCm39) H406L probably benign Het
Ric1 A T 19: 29,510,652 (GRCm39) S78C probably damaging Het
Ric1 G A 19: 29,510,653 (GRCm39) S78N probably damaging Het
Scgb1b2 G T 7: 30,991,188 (GRCm39) probably benign Het
Senp7 A G 16: 55,990,169 (GRCm39) H639R probably benign Het
Sgtb A T 13: 104,260,767 (GRCm39) D72V probably damaging Het
Slc44a5 T C 3: 153,964,086 (GRCm39) M484T probably benign Het
Slc5a1 A G 5: 33,318,140 (GRCm39) K598E probably benign Het
Slit3 T A 11: 35,503,088 (GRCm39) probably null Het
Smc1b T C 15: 85,008,003 (GRCm39) H258R probably benign Het
Smu1 T C 4: 40,744,073 (GRCm39) D318G probably damaging Het
Sned1 T A 1: 93,199,406 (GRCm39) F495L probably damaging Het
Svs3a C A 2: 164,131,804 (GRCm39) S124Y probably damaging Het
Syngr4 A G 7: 45,536,464 (GRCm39) V186A probably benign Het
Tars3 G A 7: 65,305,539 (GRCm39) M254I possibly damaging Het
Tdpoz1 T A 3: 93,578,143 (GRCm39) R214* probably null Het
Tm2d3 A G 7: 65,344,987 (GRCm39) D54G probably damaging Het
Trim66 A T 7: 109,074,320 (GRCm39) I647N probably damaging Het
Triml2 T A 8: 43,646,548 (GRCm39) W346R probably damaging Het
Trp53bp1 A T 2: 121,046,545 (GRCm39) V1085D probably benign Het
Trpv2 T C 11: 62,483,612 (GRCm39) V483A probably benign Het
Ugp2 G T 11: 21,278,949 (GRCm39) N412K probably benign Het
Vmn2r77 C A 7: 86,461,152 (GRCm39) P826Q probably damaging Het
Vrtn T C 12: 84,696,936 (GRCm39) M562T probably benign Het
Wdr55 A G 18: 36,895,419 (GRCm39) N132S possibly damaging Het
Wipf2 A T 11: 98,787,040 (GRCm39) R356S possibly damaging Het
Zdhhc6 T C 19: 55,287,228 (GRCm39) K411E probably benign Het
Zfp260 A G 7: 29,804,765 (GRCm39) K222E probably damaging Het
Zfp280d A G 9: 72,220,011 (GRCm39) N237S probably damaging Het
Zfp445 T G 9: 122,682,547 (GRCm39) S465R possibly damaging Het
Zfp821 A G 8: 110,450,979 (GRCm39) D324G probably damaging Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70,790,934 (GRCm39) missense probably benign
IGL01890:Upf1 APN 8 70,786,880 (GRCm39) missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70,788,302 (GRCm39) critical splice donor site probably null
IGL03142:Upf1 APN 8 70,785,977 (GRCm39) missense probably benign 0.04
IGL03151:Upf1 APN 8 70,788,037 (GRCm39) missense probably damaging 0.98
Nanosphere UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
Particulate UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R0270:Upf1 UTSW 8 70,788,295 (GRCm39) splice site probably benign
R0477:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R0755:Upf1 UTSW 8 70,786,779 (GRCm39) missense probably benign 0.01
R1018:Upf1 UTSW 8 70,791,556 (GRCm39) missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70,791,053 (GRCm39) missense probably damaging 0.98
R1445:Upf1 UTSW 8 70,794,174 (GRCm39) missense probably benign 0.00
R1458:Upf1 UTSW 8 70,796,904 (GRCm39) missense probably benign 0.00
R1511:Upf1 UTSW 8 70,791,155 (GRCm39) missense probably damaging 0.99
R1552:Upf1 UTSW 8 70,785,709 (GRCm39) nonsense probably null
R1560:Upf1 UTSW 8 70,791,092 (GRCm39) missense probably damaging 1.00
R1562:Upf1 UTSW 8 70,796,017 (GRCm39) nonsense probably null
R2082:Upf1 UTSW 8 70,794,222 (GRCm39) missense probably damaging 1.00
R2423:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R2425:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3031:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3032:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3123:Upf1 UTSW 8 70,790,133 (GRCm39) splice site probably benign
R3508:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3747:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70,792,464 (GRCm39) missense probably benign 0.30
R3964:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3965:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4152:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4505:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4506:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4838:Upf1 UTSW 8 70,792,018 (GRCm39) missense probably benign 0.03
R5001:Upf1 UTSW 8 70,787,350 (GRCm39) missense probably damaging 1.00
R5715:Upf1 UTSW 8 70,805,628 (GRCm39) missense probably damaging 0.96
R5748:Upf1 UTSW 8 70,791,167 (GRCm39) missense probably damaging 1.00
R5856:Upf1 UTSW 8 70,787,412 (GRCm39) critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
R6010:Upf1 UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R6056:Upf1 UTSW 8 70,785,687 (GRCm39) missense probably damaging 0.98
R6870:Upf1 UTSW 8 70,794,211 (GRCm39) missense probably benign 0.11
R7205:Upf1 UTSW 8 70,792,695 (GRCm39) missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70,793,268 (GRCm39) missense probably damaging 1.00
R7464:Upf1 UTSW 8 70,786,073 (GRCm39) missense probably benign
R7759:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R7783:Upf1 UTSW 8 70,805,508 (GRCm39) missense probably benign 0.11
R8079:Upf1 UTSW 8 70,791,534 (GRCm39) critical splice donor site probably null
R8192:Upf1 UTSW 8 70,793,294 (GRCm39) missense probably benign 0.03
R8544:Upf1 UTSW 8 70,789,702 (GRCm39) missense probably damaging 1.00
R8738:Upf1 UTSW 8 70,785,973 (GRCm39) missense probably benign 0.06
R8738:Upf1 UTSW 8 70,785,972 (GRCm39) missense probably benign 0.01
R8826:Upf1 UTSW 8 70,790,930 (GRCm39) missense probably benign
R8876:Upf1 UTSW 8 70,796,918 (GRCm39) missense possibly damaging 0.92
R8906:Upf1 UTSW 8 70,786,815 (GRCm39) nonsense probably null
R8911:Upf1 UTSW 8 70,791,087 (GRCm39) missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70,792,674 (GRCm39) missense probably benign
R9425:Upf1 UTSW 8 70,792,003 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCCAGCAGCTTGTGGTAAATATAC -3'
(R):5'- ATGTGTGAGTGAAACAGCCTG -3'

Sequencing Primer
(F):5'- TATACCCTGACACAGAGGTCTCGTC -3'
(R):5'- TGAAACAGCCTGGAGTCTGTC -3'
Posted On 2014-10-01