Mutagenetix > Incidental Mutation

Incidental Mutation 'R0201:Rapgef6'

23654

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

038458-MU

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0201 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54619941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 228 (V228A)

Ref Sequence

ENSEMBL: ENSMUSP00000099804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000108895] [ENSMUST00000207429] [ENSMUST00000218995]

AlphaFold

Q5NCJ1

Predicted Effect

probably benign
Transcript: ENSMUST00000094536

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101206
AA Change: V228A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: V228A

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102743
AA Change: V228A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: V228A

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108894

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108895
AA Change: V228A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533
AA Change: V228A

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.95e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	526	1.03e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149372

Predicted Effect

probably damaging
Transcript: ENSMUST00000207429
AA Change: V228A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218995
AA Change: V81A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220269

Meta Mutation Damage Score

0.1148

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.2%

Validation Efficiency

97% (91/94)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,581,957		probably null	Het
Adamts16	T	A	13: 70,779,644	Q492L	possibly damaging	Het
Aplnr	A	G	2: 85,137,177	D182G	probably damaging	Het
Arnt2	G	T	7: 84,361,659	S3*	probably null	Het
Asxl3	T	C	18: 22,523,154	V1407A	probably benign	Het
Atg13	A	T	2: 91,684,762		probably null	Het
Atm	A	T	9: 53,454,279		probably benign	Het
Birc6	T	G	17: 74,609,327	V1746G	possibly damaging	Het
Cbln1	G	T	8: 87,472,113	T43K	probably benign	Het
Cbx5	T	C	15: 103,199,700	T173A	probably damaging	Het
Cc2d2a	A	G	5: 43,737,512	Y1437C	probably damaging	Het
Ccdc78	C	A	17: 25,789,236		probably benign	Het
Cd2bp2	A	G	7: 127,193,828	Y341H	probably damaging	Het
Cdhr5	T	A	7: 141,276,378	D88V	probably damaging	Het
Ces1f	T	A	8: 93,267,329	T275S	probably null	Het
Clca4a	T	C	3: 144,960,717	N458S	probably benign	Het
Cog5	A	G	12: 31,839,841	K521R	probably damaging	Het
Csf2ra	T	A	19: 61,225,568	T305S	probably benign	Het
Csmd3	T	A	15: 47,619,729		probably benign	Het
Cts6	T	A	13: 61,201,499	R132*	probably null	Het
D5Ertd579e	G	T	5: 36,616,465	N195K	probably damaging	Het
Ddx1	A	G	12: 13,223,808	V606A	probably damaging	Het
Dip2b	G	A	15: 100,186,147	D884N	probably damaging	Het
Ehhadh	A	G	16: 21,773,493		probably null	Het
Enpp1	T	A	10: 24,653,917	T608S	probably benign	Het
Fancm	T	C	12: 65,101,632	Y674H	probably damaging	Het
Fat4	T	A	3: 38,891,596	V1546D	probably damaging	Het
Fsd1	G	A	17: 55,990,522	A158T	probably benign	Het
Fzd2	T	A	11: 102,606,122	M464K	probably damaging	Het
Gjc2	A	G	11: 59,177,590	F22S	possibly damaging	Het
Gm13101	T	C	4: 143,964,890	E421G	probably damaging	Het
Gria2	T	C	3: 80,707,838	Y445C	probably damaging	Het
Hsdl1	T	A	8: 119,566,256	I147F	possibly damaging	Het
Ifi44	T	C	3: 151,745,636	Y226C	probably damaging	Het
Il16	A	G	7: 83,722,308	C97R	probably damaging	Het
Impg1	A	T	9: 80,345,561	S369T	probably damaging	Het
Jmjd1c	A	G	10: 67,219,109	T390A	unknown	Het
Lgi1	A	G	19: 38,301,293	E269G	possibly damaging	Het
Lrp6	G	T	6: 134,450,897	Y1577*	probably null	Het
Lrrc74a	G	T	12: 86,761,773		probably benign	Het
Man1c1	A	T	4: 134,640,398		probably null	Het
Map1lc3b	A	C	8: 121,590,550	Q9P	possibly damaging	Het
Mboat1	G	A	13: 30,202,375	R124H	probably benign	Het
Mcu	A	G	10: 59,456,677	L60P	probably damaging	Het
Mrs2	G	T	13: 25,018,534	Q75K	probably benign	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Neb	G	A	2: 52,206,878		probably benign	Het
Nlrp2	C	T	7: 5,328,329	G356D	probably benign	Het
Notch3	A	G	17: 32,156,148		probably benign	Het
Npr2	A	C	4: 43,641,617	S474R	probably damaging	Het
Nupl1	A	G	14: 60,244,616	F100L	probably benign	Het
Osbpl6	A	C	2: 76,546,042	D87A	possibly damaging	Het
Pabpc2	A	T	18: 39,775,307	M542L	probably benign	Het
Papln	A	G	12: 83,783,027		probably benign	Het
Parpbp	T	C	10: 88,092,896	I561V	possibly damaging	Het
Pcdhb13	C	T	18: 37,442,581	A4V	probably benign	Het
Pelp1	T	C	11: 70,395,704	T533A	possibly damaging	Het
Poldip3	T	A	15: 83,135,296	M182L	probably benign	Het
Por	T	C	5: 135,731,178	S240P	possibly damaging	Het
Pramef20	A	T	4: 144,377,273		probably benign	Het
Prss22	A	T	17: 23,996,301	V167D	probably damaging	Het
Prss37	A	C	6: 40,516,349	L61R	probably damaging	Het
Psmd1	C	T	1: 86,118,616	T702M	probably benign	Het
Pxdn	G	T	12: 30,002,431	G869V	possibly damaging	Het
Rabgap1l	A	G	1: 160,453,745		probably benign	Het
Rnf169	T	C	7: 99,926,003	R462G	possibly damaging	Het
Rnft2	A	G	5: 118,194,680		probably benign	Het
Sgo2b	T	C	8: 63,926,636	D1054G	probably benign	Het
Sh3bgr	T	C	16: 96,228,517		probably benign	Het
Slc12a4	A	G	8: 105,945,350	V910A	possibly damaging	Het
Slc6a12	A	T	6: 121,355,372	I222F	probably benign	Het
Spty2d1	G	A	7: 46,997,901	R427*	probably null	Het
Ssc5d	A	G	7: 4,944,663	T1339A	probably benign	Het
Sspo	A	C	6: 48,455,752	E854A	possibly damaging	Het
Stx7	A	G	10: 24,185,079		probably benign	Het
Styk1	A	T	6: 131,301,730		probably benign	Het
Tex33	T	A	15: 78,378,828	M209L	probably damaging	Het
Tmem163	T	G	1: 127,668,637		probably benign	Het
Tmppe	C	CT	9: 114,404,639		probably null	Het
Tmx2	A	G	2: 84,673,082	V229A	probably benign	Het
Top2b	T	C	14: 16,383,174	L54P	probably damaging	Het
Trim62	A	T	4: 128,902,550	Y280F	probably benign	Het
Tssk4	A	T	14: 55,651,559	K181*	probably null	Het
Tssk4	A	T	14: 55,651,560	K181M	probably damaging	Het
Ubn1	A	G	16: 5,064,614	D313G	probably damaging	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Ugt1a10	C	T	1: 88,218,249	P473L	probably damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null
R9354:Rapgef6	UTSW	11	54619923	missense	possibly damaging	0.66
R9514:Rapgef6	UTSW	11	54552858	missense	probably benign	0.14
R9516:Rapgef6	UTSW	11	54691343	missense	probably damaging	1.00
R9739:Rapgef6	UTSW	11	54622363	missense	probably benign	0.03
R9789:Rapgef6	UTSW	11	54649271	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGCAGAAAGCATGTAAGACCTTAGATGA -3'
(R):5'- CCCCACCCCTCTGTGTTAAGATGG -3'

Sequencing Primer
(F):5'- GATGAAGCTGTCATAATCTCCAC -3'
(R):5'- CCCTCTGTGTTAAGATGGTTTTTC -3'

Posted On

2013-04-16