Incidental Mutation 'R2144:Mpv17'
ID 236603
Institutional Source Beutler Lab
Gene Symbol Mpv17
Ensembl Gene ENSMUSG00000107283
Gene Name MpV17 mitochondrial inner membrane protein
Synonyms Tg.Mpv17
MMRRC Submission 040147-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2144 (G1)
Quality Score 194
Status Not validated
Chromosome 5
Chromosomal Location 31298007-31311595 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 31311533 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088010] [ENSMUST00000101411] [ENSMUST00000154241] [ENSMUST00000200744] [ENSMUST00000201491] [ENSMUST00000202241] [ENSMUST00000200833] [ENSMUST00000200864] [ENSMUST00000201353] [ENSMUST00000202639]
AlphaFold P19258
Predicted Effect probably null
Transcript: ENSMUST00000067186
SMART Domains Protein: ENSMUSP00000064833
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088010
SMART Domains Protein: ENSMUSP00000085325
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
WD40 821 861 5.33e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101411
SMART Domains Protein: ENSMUSP00000098957
Gene: ENSMUSG00000101678

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
Blast:WD40 807 844 2e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000131391
SMART Domains Protein: ENSMUSP00000115616
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:Mpv17_PMP22 124 164 2.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136581
Predicted Effect probably null
Transcript: ENSMUST00000137165
SMART Domains Protein: ENSMUSP00000120729
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 156 4.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137409
SMART Domains Protein: ENSMUSP00000120699
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 137 150 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141823
SMART Domains Protein: ENSMUSP00000120470
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154241
SMART Domains Protein: ENSMUSP00000115292
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 175 2.2e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200744
SMART Domains Protein: ENSMUSP00000143843
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 103 163 5.7e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000201491
SMART Domains Protein: ENSMUSP00000144593
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 155 4.6e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202241
SMART Domains Protein: ENSMUSP00000144119
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200833
SMART Domains Protein: ENSMUSP00000144324
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202203
Predicted Effect probably benign
Transcript: ENSMUST00000200864
SMART Domains Protein: ENSMUSP00000144331
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201353
SMART Domains Protein: ENSMUSP00000144198
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202614
Predicted Effect probably benign
Transcript: ENSMUST00000202639
SMART Domains Protein: ENSMUSP00000144489
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial inner membrane protein that is implicated in the metabolism of reactive oxygen species. Mutations in this gene have been associated with the hepatocerebral form of mitochondrial DNA depletion syndrome (MDDS). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene develop symptoms of kidney failure similar to focal segmental glomerulosclerosis due to depletion of mitochondrial content. Inner ear degeneration is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,412 (GRCm39) T69S unknown Het
4930553M12Rik G A 4: 88,786,411 (GRCm39) T69I unknown Het
Acsl6 A T 11: 54,232,604 (GRCm39) Q485L probably damaging Het
Adam5 C A 8: 25,305,496 (GRCm39) V81F probably benign Het
Aoc1l1 A G 6: 48,952,225 (GRCm39) H50R probably benign Het
Bag2 A G 1: 33,785,912 (GRCm39) S137P possibly damaging Het
Birc6 A T 17: 74,967,408 (GRCm39) Q4103L possibly damaging Het
Camta2 A G 11: 70,562,401 (GRCm39) F999L probably benign Het
Cap2 A T 13: 46,713,978 (GRCm39) probably null Het
Ccnk T A 12: 108,155,349 (GRCm39) L102Q probably null Het
Cd52 T C 4: 133,821,048 (GRCm39) probably benign Het
Cdc123 A T 2: 5,815,617 (GRCm39) I160K probably benign Het
Cep85l T C 10: 53,234,222 (GRCm39) N52S probably benign Het
Cntnap5a C T 1: 116,029,440 (GRCm39) T298I probably benign Het
Cpsf4 G T 5: 145,115,572 (GRCm39) S192I probably benign Het
Cpxm1 A G 2: 130,239,330 (GRCm39) S33P probably benign Het
Cyp2a12 A T 7: 26,734,194 (GRCm39) T376S possibly damaging Het
Cyp3a16 A G 5: 145,392,894 (GRCm39) F137S probably damaging Het
Des A G 1: 75,343,448 (GRCm39) T444A probably benign Het
Dgcr8 C T 16: 18,102,120 (GRCm39) G54D probably damaging Het
Dmac2l A G 12: 69,787,828 (GRCm39) Q88R probably damaging Het
Dsc3 A G 18: 20,113,743 (GRCm39) F393S possibly damaging Het
Dstyk T A 1: 132,391,113 (GRCm39) M838K probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Eml5 A C 12: 98,776,864 (GRCm39) F1417C probably damaging Het
Ep400 A T 5: 110,851,384 (GRCm39) M1366K unknown Het
Epg5 G T 18: 77,997,412 (GRCm39) C425F possibly damaging Het
Epha3 C G 16: 63,593,680 (GRCm39) R136P possibly damaging Het
Extl1 C A 4: 134,098,355 (GRCm39) E225D probably benign Het
Fam186b A G 15: 99,178,538 (GRCm39) Y263H probably benign Het
Fbn2 A G 18: 58,186,065 (GRCm39) V1761A possibly damaging Het
Fer1l6 T A 15: 58,499,383 (GRCm39) M1251K probably benign Het
Gart A T 16: 91,426,969 (GRCm39) I555N probably damaging Het
Gm11596 A T 11: 99,683,789 (GRCm39) C110* probably null Het
Gnptab C T 10: 88,264,368 (GRCm39) S262L possibly damaging Het
Gpr21 T C 2: 37,408,243 (GRCm39) V263A probably benign Het
Gxylt1 T C 15: 93,152,361 (GRCm39) I224V probably benign Het
H2-Aa A G 17: 34,502,801 (GRCm39) S122P probably damaging Het
Hsph1 A C 5: 149,553,802 (GRCm39) probably null Het
Hunk G A 16: 90,229,420 (GRCm39) D94N probably damaging Het
Ikbke C A 1: 131,201,211 (GRCm39) V176L probably damaging Het
Inpp5k A T 11: 75,538,017 (GRCm39) probably null Het
Ints10 A G 8: 69,249,457 (GRCm39) T96A probably damaging Het
Kansl2 A T 15: 98,424,512 (GRCm39) V306E probably benign Het
Kif20a A G 18: 34,758,657 (GRCm39) D42G possibly damaging Het
Klhl7 A T 5: 24,305,861 (GRCm39) M37L probably benign Het
Krtap1-5 T C 11: 99,471,644 (GRCm39) I50V probably benign Het
Ktn1 A G 14: 47,952,109 (GRCm39) E983G probably damaging Het
Lrrk1 G A 7: 65,945,911 (GRCm39) S566L probably damaging Het
M6pr A G 6: 122,292,326 (GRCm39) M174V probably benign Het
Man2a2 A G 7: 80,013,264 (GRCm39) S510P probably damaging Het
Mmrn1 G A 6: 60,922,059 (GRCm39) S172N possibly damaging Het
Mrgpra9 T C 7: 46,885,211 (GRCm39) E152G probably benign Het
Mst1r T C 9: 107,790,367 (GRCm39) V660A probably benign Het
Myof A G 19: 37,969,669 (GRCm39) probably null Het
Myrf G A 19: 10,206,038 (GRCm39) P126L probably benign Het
Nckap1l C T 15: 103,384,103 (GRCm39) A567V probably damaging Het
Nphs1 A G 7: 30,160,395 (GRCm39) E169G probably benign Het
Npy1r T A 8: 67,157,836 (GRCm39) V382D probably benign Het
Nrl A T 14: 55,758,307 (GRCm39) M140K possibly damaging Het
Odad2 C T 18: 7,127,229 (GRCm39) E995K probably damaging Het
Or14c39 T A 7: 86,344,488 (GRCm39) F275I probably damaging Het
Or2ag1b A T 7: 106,288,164 (GRCm39) M258K probably damaging Het
Or4f56 A G 2: 111,703,768 (GRCm39) I144T probably damaging Het
Or5ac17 C T 16: 59,036,389 (GRCm39) V196M probably benign Het
Or8d2 C T 9: 38,759,635 (GRCm39) T75I probably damaging Het
Orc5 T A 5: 22,752,925 (GRCm39) L36F possibly damaging Het
Osbpl1a A T 18: 13,004,230 (GRCm39) S396T probably benign Het
Pappa T A 4: 65,099,186 (GRCm39) Y568* probably null Het
Pask C T 1: 93,249,019 (GRCm39) A794T probably benign Het
Pclo C T 5: 14,908,766 (GRCm39) L5025F unknown Het
Pde3a T C 6: 141,435,837 (GRCm39) V924A probably benign Het
Pdpr A G 8: 111,844,668 (GRCm39) N355S probably damaging Het
Pepd A T 7: 34,620,843 (GRCm39) K36M probably benign Het
Pet100 T G 8: 3,672,355 (GRCm39) L14R probably damaging Het
Pfkfb2 T C 1: 130,626,460 (GRCm39) T438A probably benign Het
Pik3r6 T A 11: 68,434,437 (GRCm39) L546* probably null Het
Pira2 A T 7: 3,847,344 (GRCm39) L115Q probably damaging Het
Plxdc1 T C 11: 97,824,838 (GRCm39) Y339C probably damaging Het
Primpol A T 8: 47,039,378 (GRCm39) M414K probably damaging Het
Prol1 A T 5: 88,476,254 (GRCm39) T215S unknown Het
Prss22 A G 17: 24,213,656 (GRCm39) Y212H probably damaging Het
Ralgapa2 C A 2: 146,230,524 (GRCm39) V1014L probably damaging Het
Rap1gap2 G A 11: 74,316,802 (GRCm39) T245M probably damaging Het
Rbm26 T A 14: 105,352,638 (GRCm39) R1009* probably null Het
Rbm42 A G 7: 30,340,535 (GRCm39) *450Q probably null Het
Rere T C 4: 150,701,388 (GRCm39) V1256A probably damaging Het
Rmi1 G T 13: 58,555,797 (GRCm39) L15F probably damaging Het
Rnf213 T C 11: 119,334,516 (GRCm39) S3242P probably damaging Het
Rtel1 T A 2: 180,965,499 (GRCm39) V167E probably damaging Het
Scgb1b2 G T 7: 30,991,188 (GRCm39) probably benign Het
Sin3b T C 8: 73,457,893 (GRCm39) L203P probably damaging Het
Skint6 T C 4: 113,093,457 (GRCm39) S229G possibly damaging Het
Slco1a4 T C 6: 141,755,104 (GRCm39) Y566C probably damaging Het
Smgc T G 15: 91,728,624 (GRCm39) D121E possibly damaging Het
Sned1 T A 1: 93,199,406 (GRCm39) F495L probably damaging Het
St7 A T 6: 17,886,006 (GRCm39) N52I possibly damaging Het
Sycn C A 7: 28,240,494 (GRCm39) Q54K probably benign Het
Syngr4 A G 7: 45,536,464 (GRCm39) V186A probably benign Het
Tars3 G A 7: 65,305,539 (GRCm39) M254I possibly damaging Het
Tcaf2 A T 6: 42,619,738 (GRCm39) H96Q probably benign Het
Tcp11l2 T C 10: 84,449,363 (GRCm39) Y443H probably damaging Het
Tmem200c A T 17: 69,149,244 (GRCm39) Q609L possibly damaging Het
Tmx3 G A 18: 90,535,614 (GRCm39) G83R probably damaging Het
Tpgs2 A C 18: 25,301,598 (GRCm39) V23G possibly damaging Het
Trhr T C 15: 44,060,579 (GRCm39) V33A probably benign Het
Trim66 A T 7: 109,074,320 (GRCm39) I647N probably damaging Het
Trnt1 A G 6: 106,755,000 (GRCm39) K244E probably damaging Het
Tsfm G A 10: 126,864,314 (GRCm39) Q134* probably null Het
Ttll9 A G 2: 152,844,927 (GRCm39) T432A probably benign Het
Vmn2r78 C T 7: 86,603,690 (GRCm39) L623F probably damaging Het
Wdr55 A G 18: 36,895,419 (GRCm39) N132S possibly damaging Het
Wipf2 A T 11: 98,787,040 (GRCm39) R356S possibly damaging Het
Wnk1 A G 6: 119,925,949 (GRCm39) probably benign Het
Zfp260 A G 7: 29,804,765 (GRCm39) K222E probably damaging Het
Zfp300 A G X: 20,948,190 (GRCm39) S525P possibly damaging Het
Zfp592 A G 7: 80,687,950 (GRCm39) T959A probably benign Het
Other mutations in Mpv17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1672:Mpv17 UTSW 5 31,311,063 (GRCm39) missense probably damaging 1.00
R4755:Mpv17 UTSW 5 31,303,326 (GRCm39) nonsense probably null
R6545:Mpv17 UTSW 5 31,302,041 (GRCm39) splice site probably benign
R8341:Mpv17 UTSW 5 31,311,447 (GRCm39) start gained probably null
Predicted Primers PCR Primer
(F):5'- AAGGCATCCAGTCCTGATTAAGAC -3'
(R):5'- TCGCAAGGGGTATCAAAGGC -3'

Sequencing Primer
(F):5'- TCCAGTCCTGATTAAGACACTCATG -3'
(R):5'- AGGGGTATCAAAGGCCCCAC -3'
Posted On 2014-10-01