Incidental Mutation 'R2144:Mpv17'
ID236603
Institutional Source Beutler Lab
Gene Symbol Mpv17
Ensembl Gene ENSMUSG00000107283
Gene NameMpV17 mitochondrial inner membrane protein
SynonymsTg.Mpv17
MMRRC Submission 040147-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2144 (G1)
Quality Score194
Status Not validated
Chromosome5
Chromosomal Location31140654-31154251 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 31154189 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088010] [ENSMUST00000101411] [ENSMUST00000154241] [ENSMUST00000200744] [ENSMUST00000200833] [ENSMUST00000200864] [ENSMUST00000201491] [ENSMUST00000202241] [ENSMUST00000201353] [ENSMUST00000202639]
Predicted Effect probably null
Transcript: ENSMUST00000067186
SMART Domains Protein: ENSMUSP00000064833
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088010
SMART Domains Protein: ENSMUSP00000085325
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
WD40 821 861 5.33e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101411
SMART Domains Protein: ENSMUSP00000098957
Gene: ENSMUSG00000101678

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
Blast:WD40 807 844 2e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000131391
SMART Domains Protein: ENSMUSP00000115616
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:Mpv17_PMP22 124 164 2.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136581
Predicted Effect probably null
Transcript: ENSMUST00000137165
SMART Domains Protein: ENSMUSP00000120729
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 156 4.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137409
SMART Domains Protein: ENSMUSP00000120699
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 137 150 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141823
SMART Domains Protein: ENSMUSP00000120470
Gene: ENSMUSG00000090262

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154241
SMART Domains Protein: ENSMUSP00000115292
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 175 2.2e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200744
SMART Domains Protein: ENSMUSP00000143843
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 103 163 5.7e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200833
SMART Domains Protein: ENSMUSP00000144324
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200864
SMART Domains Protein: ENSMUSP00000144331
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202375
Predicted Effect probably null
Transcript: ENSMUST00000201491
SMART Domains Protein: ENSMUSP00000144593
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 155 4.6e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202241
SMART Domains Protein: ENSMUSP00000144119
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202203
Predicted Effect probably benign
Transcript: ENSMUST00000201353
SMART Domains Protein: ENSMUSP00000144198
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202639
SMART Domains Protein: ENSMUSP00000144489
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial inner membrane protein that is implicated in the metabolism of reactive oxygen species. Mutations in this gene have been associated with the hepatocerebral form of mitochondrial DNA depletion syndrome (MDDS). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene develop symptoms of kidney failure similar to focal segmental glomerulosclerosis due to depletion of mitochondrial content. Inner ear degeneration is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Acsl6 A T 11: 54,341,778 Q485L probably damaging Het
Adam5 C A 8: 24,815,480 V81F probably benign Het
Armc4 C T 18: 7,127,229 E995K probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Cap2 A T 13: 46,560,502 probably null Het
Ccnk T A 12: 108,189,090 L102Q probably null Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdc123 A T 2: 5,810,806 I160K probably benign Het
Cep85l T C 10: 53,358,126 N52S probably benign Het
Cntnap5a C T 1: 116,101,710 T298I probably benign Het
Cpsf4 G T 5: 145,178,762 S192I probably benign Het
Cpxm1 A G 2: 130,397,410 S33P probably benign Het
Cyp2a12 A T 7: 27,034,769 T376S possibly damaging Het
Cyp3a16 A G 5: 145,456,084 F137S probably damaging Het
Des A G 1: 75,366,804 T444A probably benign Het
Dgcr8 C T 16: 18,284,256 G54D probably damaging Het
Doxl2 A G 6: 48,975,291 H50R probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Ep400 A T 5: 110,703,518 M1366K unknown Het
Epg5 G T 18: 77,954,197 C425F possibly damaging Het
Epha3 C G 16: 63,773,317 R136P possibly damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fam186b A G 15: 99,280,657 Y263H probably benign Het
Fbn2 A G 18: 58,052,993 V1761A possibly damaging Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Gart A T 16: 91,630,081 I555N probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gnptab C T 10: 88,428,506 S262L possibly damaging Het
Gpr21 T C 2: 37,518,231 V263A probably benign Het
Gxylt1 T C 15: 93,254,480 I224V probably benign Het
H2-Aa A G 17: 34,283,827 S122P probably damaging Het
Hsph1 A C 5: 149,630,337 probably null Het
Hunk G A 16: 90,432,532 D94N probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Ints10 A G 8: 68,796,805 T96A probably damaging Het
Kansl2 A T 15: 98,526,631 V306E probably benign Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Ktn1 A G 14: 47,714,652 E983G probably damaging Het
Lrrk1 G A 7: 66,296,163 S566L probably damaging Het
M6pr A G 6: 122,315,367 M174V probably benign Het
Man2a2 A G 7: 80,363,516 S510P probably damaging Het
Mmrn1 G A 6: 60,945,075 S172N possibly damaging Het
Mrgpra9 T C 7: 47,235,463 E152G probably benign Het
Mst1r T C 9: 107,913,168 V660A probably benign Het
Myof A G 19: 37,981,221 probably null Het
Myrf G A 19: 10,228,674 P126L probably benign Het
Nckap1l C T 15: 103,475,676 A567V probably damaging Het
Nphs1 A G 7: 30,460,970 E169G probably benign Het
Npy1r T A 8: 66,705,184 V382D probably benign Het
Nrl A T 14: 55,520,850 M140K possibly damaging Het
Olfr1305 A G 2: 111,873,423 I144T probably damaging Het
Olfr199 C T 16: 59,216,026 V196M probably benign Het
Olfr292 T A 7: 86,695,280 F275I probably damaging Het
Olfr694 A T 7: 106,688,957 M258K probably damaging Het
Olfr924 C T 9: 38,848,339 T75I probably damaging Het
Orc5 T A 5: 22,547,927 L36F possibly damaging Het
Osbpl1a A T 18: 12,871,173 S396T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pclo C T 5: 14,858,752 L5025F unknown Het
Pde3a T C 6: 141,490,111 V924A probably benign Het
Pdpr A G 8: 111,118,036 N355S probably damaging Het
Pepd A T 7: 34,921,418 K36M probably benign Het
Pet100 T G 8: 3,622,355 L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pik3r6 T A 11: 68,543,611 L546* probably null Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Primpol A T 8: 46,586,343 M414K probably damaging Het
Prol1 A T 5: 88,328,395 T215S unknown Het
Prss22 A G 17: 23,994,682 Y212H probably damaging Het
Ralgapa2 C A 2: 146,388,604 V1014L probably damaging Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rbm26 T A 14: 105,115,202 R1009* probably null Het
Rbm42 A G 7: 30,641,110 *450Q probably null Het
Rere T C 4: 150,616,931 V1256A probably damaging Het
Rmi1 G T 13: 58,407,983 L15F probably damaging Het
Rnf213 T C 11: 119,443,690 S3242P probably damaging Het
Rtel1 T A 2: 181,323,706 V167E probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Sin3b T C 8: 72,731,265 L203P probably damaging Het
Skint6 T C 4: 113,236,260 S229G possibly damaging Het
Slco1a4 T C 6: 141,809,378 Y566C probably damaging Het
Smgc T G 15: 91,844,421 D121E possibly damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
St7 A T 6: 17,886,007 N52I possibly damaging Het
Sycn C A 7: 28,541,069 Q54K probably benign Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tcaf2 A T 6: 42,642,804 H96Q probably benign Het
Tcp11l2 T C 10: 84,613,499 Y443H probably damaging Het
Tmem200c A T 17: 68,842,249 Q609L possibly damaging Het
Tmx3 G A 18: 90,517,490 G83R probably damaging Het
Tpgs2 A C 18: 25,168,541 V23G possibly damaging Het
Trhr T C 15: 44,197,183 V33A probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Trnt1 A G 6: 106,778,039 K244E probably damaging Het
Tsfm G A 10: 127,028,445 Q134* probably null Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vmn2r78 C T 7: 86,954,482 L623F probably damaging Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Wnk1 A G 6: 119,948,988 probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp592 A G 7: 81,038,202 T959A probably benign Het
Other mutations in Mpv17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1672:Mpv17 UTSW 5 31153719 missense probably damaging 1.00
R4755:Mpv17 UTSW 5 31145982 nonsense probably null
R6545:Mpv17 UTSW 5 31144697 splice site probably benign
R8341:Mpv17 UTSW 5 31154103 start gained probably null
Predicted Primers PCR Primer
(F):5'- AAGGCATCCAGTCCTGATTAAGAC -3'
(R):5'- TCGCAAGGGGTATCAAAGGC -3'

Sequencing Primer
(F):5'- TCCAGTCCTGATTAAGACACTCATG -3'
(R):5'- AGGGGTATCAAAGGCCCCAC -3'
Posted On2014-10-01