Incidental Mutation 'R2144:Mmrn1'
ID236612
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Namemultimerin 1
Synonyms4921530G03Rik, Emilin4
MMRRC Submission 040147-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2144 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location60924976-60989378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60945075 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 172 (S172N)
Ref Sequence ENSEMBL: ENSMUSP00000145156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
Predicted Effect possibly damaging
Transcript: ENSMUST00000129603
AA Change: S172N

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: S172N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145763
Predicted Effect possibly damaging
Transcript: ENSMUST00000204333
AA Change: S172N

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: S172N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Acsl6 A T 11: 54,341,778 Q485L probably damaging Het
Adam5 C A 8: 24,815,480 V81F probably benign Het
Armc4 C T 18: 7,127,229 E995K probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Cap2 A T 13: 46,560,502 probably null Het
Ccnk T A 12: 108,189,090 L102Q probably null Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdc123 A T 2: 5,810,806 I160K probably benign Het
Cep85l T C 10: 53,358,126 N52S probably benign Het
Cntnap5a C T 1: 116,101,710 T298I probably benign Het
Cpsf4 G T 5: 145,178,762 S192I probably benign Het
Cpxm1 A G 2: 130,397,410 S33P probably benign Het
Cyp2a12 A T 7: 27,034,769 T376S possibly damaging Het
Cyp3a16 A G 5: 145,456,084 F137S probably damaging Het
Des A G 1: 75,366,804 T444A probably benign Het
Dgcr8 C T 16: 18,284,256 G54D probably damaging Het
Doxl2 A G 6: 48,975,291 H50R probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Ep400 A T 5: 110,703,518 M1366K unknown Het
Epg5 G T 18: 77,954,197 C425F possibly damaging Het
Epha3 C G 16: 63,773,317 R136P possibly damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fam186b A G 15: 99,280,657 Y263H probably benign Het
Fbn2 A G 18: 58,052,993 V1761A possibly damaging Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Gart A T 16: 91,630,081 I555N probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gnptab C T 10: 88,428,506 S262L possibly damaging Het
Gpr21 T C 2: 37,518,231 V263A probably benign Het
Gxylt1 T C 15: 93,254,480 I224V probably benign Het
H2-Aa A G 17: 34,283,827 S122P probably damaging Het
Hsph1 A C 5: 149,630,337 probably null Het
Hunk G A 16: 90,432,532 D94N probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Ints10 A G 8: 68,796,805 T96A probably damaging Het
Kansl2 A T 15: 98,526,631 V306E probably benign Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Ktn1 A G 14: 47,714,652 E983G probably damaging Het
Lrrk1 G A 7: 66,296,163 S566L probably damaging Het
M6pr A G 6: 122,315,367 M174V probably benign Het
Man2a2 A G 7: 80,363,516 S510P probably damaging Het
Mpv17 A G 5: 31,154,189 probably null Het
Mrgpra9 T C 7: 47,235,463 E152G probably benign Het
Mst1r T C 9: 107,913,168 V660A probably benign Het
Myof A G 19: 37,981,221 probably null Het
Myrf G A 19: 10,228,674 P126L probably benign Het
Nckap1l C T 15: 103,475,676 A567V probably damaging Het
Nphs1 A G 7: 30,460,970 E169G probably benign Het
Npy1r T A 8: 66,705,184 V382D probably benign Het
Nrl A T 14: 55,520,850 M140K possibly damaging Het
Olfr1305 A G 2: 111,873,423 I144T probably damaging Het
Olfr199 C T 16: 59,216,026 V196M probably benign Het
Olfr292 T A 7: 86,695,280 F275I probably damaging Het
Olfr694 A T 7: 106,688,957 M258K probably damaging Het
Olfr924 C T 9: 38,848,339 T75I probably damaging Het
Orc5 T A 5: 22,547,927 L36F possibly damaging Het
Osbpl1a A T 18: 12,871,173 S396T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pclo C T 5: 14,858,752 L5025F unknown Het
Pde3a T C 6: 141,490,111 V924A probably benign Het
Pdpr A G 8: 111,118,036 N355S probably damaging Het
Pepd A T 7: 34,921,418 K36M probably benign Het
Pet100 T G 8: 3,622,355 L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pik3r6 T A 11: 68,543,611 L546* probably null Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Primpol A T 8: 46,586,343 M414K probably damaging Het
Prol1 A T 5: 88,328,395 T215S unknown Het
Prss22 A G 17: 23,994,682 Y212H probably damaging Het
Ralgapa2 C A 2: 146,388,604 V1014L probably damaging Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rbm26 T A 14: 105,115,202 R1009* probably null Het
Rbm42 A G 7: 30,641,110 *450Q probably null Het
Rere T C 4: 150,616,931 V1256A probably damaging Het
Rmi1 G T 13: 58,407,983 L15F probably damaging Het
Rnf213 T C 11: 119,443,690 S3242P probably damaging Het
Rtel1 T A 2: 181,323,706 V167E probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Sin3b T C 8: 72,731,265 L203P probably damaging Het
Skint6 T C 4: 113,236,260 S229G possibly damaging Het
Slco1a4 T C 6: 141,809,378 Y566C probably damaging Het
Smgc T G 15: 91,844,421 D121E possibly damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
St7 A T 6: 17,886,007 N52I possibly damaging Het
Sycn C A 7: 28,541,069 Q54K probably benign Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tcaf2 A T 6: 42,642,804 H96Q probably benign Het
Tcp11l2 T C 10: 84,613,499 Y443H probably damaging Het
Tmem200c A T 17: 68,842,249 Q609L possibly damaging Het
Tmx3 G A 18: 90,517,490 G83R probably damaging Het
Tpgs2 A C 18: 25,168,541 V23G possibly damaging Het
Trhr T C 15: 44,197,183 V33A probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Trnt1 A G 6: 106,778,039 K244E probably damaging Het
Tsfm G A 10: 127,028,445 Q134* probably null Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vmn2r78 C T 7: 86,954,482 L623F probably damaging Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Wnk1 A G 6: 119,948,988 probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp592 A G 7: 81,038,202 T959A probably benign Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60987060 splice site probably null
R7979:Mmrn1 UTSW 6 60975977 missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60944524 start gained probably benign
R8130:Mmrn1 UTSW 6 60960723 missense probably damaging 1.00
R8277:Mmrn1 UTSW 6 60977236 missense probably benign 0.19
R8353:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8453:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60987098 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACAGGGACAGCAGTGGTATC -3'
(R):5'- CTCTGCCTGAGATTTTGAAACCTG -3'

Sequencing Primer
(F):5'- ACAGCAGTGGTATCCCTGC -3'
(R):5'- CCTGAGATTTTGAAACCTGATGTAAC -3'
Posted On2014-10-01