Incidental Mutation 'R2144:Tars3'
ID 236630
Institutional Source Beutler Lab
Gene Symbol Tars3
Ensembl Gene ENSMUSG00000030515
Gene Name threonyl-tRNA synthetase 3
Synonyms A530046H20Rik, Tarsl2
MMRRC Submission 040147-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R2144 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 65294646-65341839 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65305539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 254 (M254I)
Ref Sequence ENSEMBL: ENSMUSP00000032728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032728]
AlphaFold Q8BLY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000032728
AA Change: M254I

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032728
Gene: ENSMUSG00000030515
AA Change: M254I

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
coiled coil region 44 68 N/A INTRINSIC
Pfam:TGS 151 210 8.8e-14 PFAM
tRNA_SAD 316 365 1.26e-16 SMART
Pfam:tRNA-synt_2b 464 675 2.2e-35 PFAM
Pfam:HGTP_anticodon 687 778 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206323
Meta Mutation Damage Score 0.2028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,412 (GRCm39) T69S unknown Het
4930553M12Rik G A 4: 88,786,411 (GRCm39) T69I unknown Het
Acsl6 A T 11: 54,232,604 (GRCm39) Q485L probably damaging Het
Adam5 C A 8: 25,305,496 (GRCm39) V81F probably benign Het
Aoc1l1 A G 6: 48,952,225 (GRCm39) H50R probably benign Het
Bag2 A G 1: 33,785,912 (GRCm39) S137P possibly damaging Het
Birc6 A T 17: 74,967,408 (GRCm39) Q4103L possibly damaging Het
Camta2 A G 11: 70,562,401 (GRCm39) F999L probably benign Het
Cap2 A T 13: 46,713,978 (GRCm39) probably null Het
Ccnk T A 12: 108,155,349 (GRCm39) L102Q probably null Het
Cd52 T C 4: 133,821,048 (GRCm39) probably benign Het
Cdc123 A T 2: 5,815,617 (GRCm39) I160K probably benign Het
Cep85l T C 10: 53,234,222 (GRCm39) N52S probably benign Het
Cntnap5a C T 1: 116,029,440 (GRCm39) T298I probably benign Het
Cpsf4 G T 5: 145,115,572 (GRCm39) S192I probably benign Het
Cpxm1 A G 2: 130,239,330 (GRCm39) S33P probably benign Het
Cyp2a12 A T 7: 26,734,194 (GRCm39) T376S possibly damaging Het
Cyp3a16 A G 5: 145,392,894 (GRCm39) F137S probably damaging Het
Des A G 1: 75,343,448 (GRCm39) T444A probably benign Het
Dgcr8 C T 16: 18,102,120 (GRCm39) G54D probably damaging Het
Dmac2l A G 12: 69,787,828 (GRCm39) Q88R probably damaging Het
Dsc3 A G 18: 20,113,743 (GRCm39) F393S possibly damaging Het
Dstyk T A 1: 132,391,113 (GRCm39) M838K probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Eml5 A C 12: 98,776,864 (GRCm39) F1417C probably damaging Het
Ep400 A T 5: 110,851,384 (GRCm39) M1366K unknown Het
Epg5 G T 18: 77,997,412 (GRCm39) C425F possibly damaging Het
Epha3 C G 16: 63,593,680 (GRCm39) R136P possibly damaging Het
Extl1 C A 4: 134,098,355 (GRCm39) E225D probably benign Het
Fam186b A G 15: 99,178,538 (GRCm39) Y263H probably benign Het
Fbn2 A G 18: 58,186,065 (GRCm39) V1761A possibly damaging Het
Fer1l6 T A 15: 58,499,383 (GRCm39) M1251K probably benign Het
Gart A T 16: 91,426,969 (GRCm39) I555N probably damaging Het
Gm11596 A T 11: 99,683,789 (GRCm39) C110* probably null Het
Gnptab C T 10: 88,264,368 (GRCm39) S262L possibly damaging Het
Gpr21 T C 2: 37,408,243 (GRCm39) V263A probably benign Het
Gxylt1 T C 15: 93,152,361 (GRCm39) I224V probably benign Het
H2-Aa A G 17: 34,502,801 (GRCm39) S122P probably damaging Het
Hsph1 A C 5: 149,553,802 (GRCm39) probably null Het
Hunk G A 16: 90,229,420 (GRCm39) D94N probably damaging Het
Ikbke C A 1: 131,201,211 (GRCm39) V176L probably damaging Het
Inpp5k A T 11: 75,538,017 (GRCm39) probably null Het
Ints10 A G 8: 69,249,457 (GRCm39) T96A probably damaging Het
Kansl2 A T 15: 98,424,512 (GRCm39) V306E probably benign Het
Kif20a A G 18: 34,758,657 (GRCm39) D42G possibly damaging Het
Klhl7 A T 5: 24,305,861 (GRCm39) M37L probably benign Het
Krtap1-5 T C 11: 99,471,644 (GRCm39) I50V probably benign Het
Ktn1 A G 14: 47,952,109 (GRCm39) E983G probably damaging Het
Lrrk1 G A 7: 65,945,911 (GRCm39) S566L probably damaging Het
M6pr A G 6: 122,292,326 (GRCm39) M174V probably benign Het
Man2a2 A G 7: 80,013,264 (GRCm39) S510P probably damaging Het
Mmrn1 G A 6: 60,922,059 (GRCm39) S172N possibly damaging Het
Mpv17 A G 5: 31,311,533 (GRCm39) probably null Het
Mrgpra9 T C 7: 46,885,211 (GRCm39) E152G probably benign Het
Mst1r T C 9: 107,790,367 (GRCm39) V660A probably benign Het
Myof A G 19: 37,969,669 (GRCm39) probably null Het
Myrf G A 19: 10,206,038 (GRCm39) P126L probably benign Het
Nckap1l C T 15: 103,384,103 (GRCm39) A567V probably damaging Het
Nphs1 A G 7: 30,160,395 (GRCm39) E169G probably benign Het
Npy1r T A 8: 67,157,836 (GRCm39) V382D probably benign Het
Nrl A T 14: 55,758,307 (GRCm39) M140K possibly damaging Het
Odad2 C T 18: 7,127,229 (GRCm39) E995K probably damaging Het
Or14c39 T A 7: 86,344,488 (GRCm39) F275I probably damaging Het
Or2ag1b A T 7: 106,288,164 (GRCm39) M258K probably damaging Het
Or4f56 A G 2: 111,703,768 (GRCm39) I144T probably damaging Het
Or5ac17 C T 16: 59,036,389 (GRCm39) V196M probably benign Het
Or8d2 C T 9: 38,759,635 (GRCm39) T75I probably damaging Het
Orc5 T A 5: 22,752,925 (GRCm39) L36F possibly damaging Het
Osbpl1a A T 18: 13,004,230 (GRCm39) S396T probably benign Het
Pappa T A 4: 65,099,186 (GRCm39) Y568* probably null Het
Pask C T 1: 93,249,019 (GRCm39) A794T probably benign Het
Pclo C T 5: 14,908,766 (GRCm39) L5025F unknown Het
Pde3a T C 6: 141,435,837 (GRCm39) V924A probably benign Het
Pdpr A G 8: 111,844,668 (GRCm39) N355S probably damaging Het
Pepd A T 7: 34,620,843 (GRCm39) K36M probably benign Het
Pet100 T G 8: 3,672,355 (GRCm39) L14R probably damaging Het
Pfkfb2 T C 1: 130,626,460 (GRCm39) T438A probably benign Het
Pik3r6 T A 11: 68,434,437 (GRCm39) L546* probably null Het
Pira2 A T 7: 3,847,344 (GRCm39) L115Q probably damaging Het
Plxdc1 T C 11: 97,824,838 (GRCm39) Y339C probably damaging Het
Primpol A T 8: 47,039,378 (GRCm39) M414K probably damaging Het
Prol1 A T 5: 88,476,254 (GRCm39) T215S unknown Het
Prss22 A G 17: 24,213,656 (GRCm39) Y212H probably damaging Het
Ralgapa2 C A 2: 146,230,524 (GRCm39) V1014L probably damaging Het
Rap1gap2 G A 11: 74,316,802 (GRCm39) T245M probably damaging Het
Rbm26 T A 14: 105,352,638 (GRCm39) R1009* probably null Het
Rbm42 A G 7: 30,340,535 (GRCm39) *450Q probably null Het
Rere T C 4: 150,701,388 (GRCm39) V1256A probably damaging Het
Rmi1 G T 13: 58,555,797 (GRCm39) L15F probably damaging Het
Rnf213 T C 11: 119,334,516 (GRCm39) S3242P probably damaging Het
Rtel1 T A 2: 180,965,499 (GRCm39) V167E probably damaging Het
Scgb1b2 G T 7: 30,991,188 (GRCm39) probably benign Het
Sin3b T C 8: 73,457,893 (GRCm39) L203P probably damaging Het
Skint6 T C 4: 113,093,457 (GRCm39) S229G possibly damaging Het
Slco1a4 T C 6: 141,755,104 (GRCm39) Y566C probably damaging Het
Smgc T G 15: 91,728,624 (GRCm39) D121E possibly damaging Het
Sned1 T A 1: 93,199,406 (GRCm39) F495L probably damaging Het
St7 A T 6: 17,886,006 (GRCm39) N52I possibly damaging Het
Sycn C A 7: 28,240,494 (GRCm39) Q54K probably benign Het
Syngr4 A G 7: 45,536,464 (GRCm39) V186A probably benign Het
Tcaf2 A T 6: 42,619,738 (GRCm39) H96Q probably benign Het
Tcp11l2 T C 10: 84,449,363 (GRCm39) Y443H probably damaging Het
Tmem200c A T 17: 69,149,244 (GRCm39) Q609L possibly damaging Het
Tmx3 G A 18: 90,535,614 (GRCm39) G83R probably damaging Het
Tpgs2 A C 18: 25,301,598 (GRCm39) V23G possibly damaging Het
Trhr T C 15: 44,060,579 (GRCm39) V33A probably benign Het
Trim66 A T 7: 109,074,320 (GRCm39) I647N probably damaging Het
Trnt1 A G 6: 106,755,000 (GRCm39) K244E probably damaging Het
Tsfm G A 10: 126,864,314 (GRCm39) Q134* probably null Het
Ttll9 A G 2: 152,844,927 (GRCm39) T432A probably benign Het
Vmn2r78 C T 7: 86,603,690 (GRCm39) L623F probably damaging Het
Wdr55 A G 18: 36,895,419 (GRCm39) N132S possibly damaging Het
Wipf2 A T 11: 98,787,040 (GRCm39) R356S possibly damaging Het
Wnk1 A G 6: 119,925,949 (GRCm39) probably benign Het
Zfp260 A G 7: 29,804,765 (GRCm39) K222E probably damaging Het
Zfp300 A G X: 20,948,190 (GRCm39) S525P possibly damaging Het
Zfp592 A G 7: 80,687,950 (GRCm39) T959A probably benign Het
Other mutations in Tars3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tars3 APN 7 65,302,007 (GRCm39) critical splice acceptor site probably null
IGL00470:Tars3 APN 7 65,338,656 (GRCm39) missense probably benign 0.03
IGL00594:Tars3 APN 7 65,325,880 (GRCm39) critical splice donor site probably null
IGL01352:Tars3 APN 7 65,308,658 (GRCm39) missense possibly damaging 0.80
IGL01519:Tars3 APN 7 65,313,634 (GRCm39) missense probably damaging 1.00
IGL01726:Tars3 APN 7 65,332,566 (GRCm39) missense possibly damaging 0.46
IGL02370:Tars3 APN 7 65,310,913 (GRCm39) missense probably benign 0.17
IGL02729:Tars3 APN 7 65,332,567 (GRCm39) missense probably damaging 0.97
IGL03234:Tars3 APN 7 65,302,026 (GRCm39) missense probably benign 0.06
gary UTSW 7 65,338,700 (GRCm39) critical splice donor site probably null
R8254_tarsl2_650 UTSW 7 65,325,809 (GRCm39) missense probably benign
smart_money UTSW 7 65,327,890 (GRCm39) missense probably damaging 1.00
R0127:Tars3 UTSW 7 65,314,717 (GRCm39) missense probably benign 0.19
R0153:Tars3 UTSW 7 65,333,829 (GRCm39) missense probably damaging 1.00
R0605:Tars3 UTSW 7 65,327,819 (GRCm39) missense probably damaging 1.00
R1070:Tars3 UTSW 7 65,305,444 (GRCm39) missense probably damaging 1.00
R1450:Tars3 UTSW 7 65,297,244 (GRCm39) missense probably benign 0.01
R1467:Tars3 UTSW 7 65,305,444 (GRCm39) missense probably damaging 1.00
R1467:Tars3 UTSW 7 65,305,444 (GRCm39) missense probably damaging 1.00
R2142:Tars3 UTSW 7 65,308,645 (GRCm39) missense probably benign
R2143:Tars3 UTSW 7 65,305,539 (GRCm39) missense possibly damaging 0.57
R2145:Tars3 UTSW 7 65,305,539 (GRCm39) missense possibly damaging 0.57
R2208:Tars3 UTSW 7 65,332,596 (GRCm39) missense probably damaging 1.00
R3713:Tars3 UTSW 7 65,338,700 (GRCm39) critical splice donor site probably null
R3715:Tars3 UTSW 7 65,338,700 (GRCm39) critical splice donor site probably null
R3914:Tars3 UTSW 7 65,333,556 (GRCm39) missense probably benign 0.05
R3929:Tars3 UTSW 7 65,333,791 (GRCm39) splice site probably null
R4008:Tars3 UTSW 7 65,327,876 (GRCm39) missense probably damaging 1.00
R4064:Tars3 UTSW 7 65,302,018 (GRCm39) missense possibly damaging 0.90
R4367:Tars3 UTSW 7 65,332,567 (GRCm39) missense probably damaging 0.97
R4652:Tars3 UTSW 7 65,339,717 (GRCm39) missense probably damaging 1.00
R4825:Tars3 UTSW 7 65,297,302 (GRCm39) missense probably benign 0.38
R4901:Tars3 UTSW 7 65,341,042 (GRCm39) missense probably benign 0.05
R4999:Tars3 UTSW 7 65,308,683 (GRCm39) missense probably damaging 0.99
R5423:Tars3 UTSW 7 65,333,567 (GRCm39) missense probably benign 0.00
R5756:Tars3 UTSW 7 65,325,724 (GRCm39) missense probably benign 0.22
R5772:Tars3 UTSW 7 65,333,873 (GRCm39) missense probably damaging 1.00
R6160:Tars3 UTSW 7 65,332,527 (GRCm39) missense probably benign 0.32
R6230:Tars3 UTSW 7 65,336,184 (GRCm39) splice site probably null
R6424:Tars3 UTSW 7 65,305,487 (GRCm39) missense probably damaging 1.00
R6615:Tars3 UTSW 7 65,327,890 (GRCm39) missense probably damaging 1.00
R6792:Tars3 UTSW 7 65,312,051 (GRCm39) missense probably damaging 1.00
R7350:Tars3 UTSW 7 65,308,672 (GRCm39) missense probably damaging 1.00
R7549:Tars3 UTSW 7 65,297,341 (GRCm39) missense probably damaging 0.96
R7592:Tars3 UTSW 7 65,308,619 (GRCm39) missense probably benign 0.01
R7634:Tars3 UTSW 7 65,325,760 (GRCm39) missense probably damaging 0.99
R7710:Tars3 UTSW 7 65,314,717 (GRCm39) missense probably benign 0.19
R7808:Tars3 UTSW 7 65,302,009 (GRCm39) missense probably benign 0.01
R7875:Tars3 UTSW 7 65,327,899 (GRCm39) missense probably benign 0.05
R8254:Tars3 UTSW 7 65,325,809 (GRCm39) missense probably benign
R8793:Tars3 UTSW 7 65,294,673 (GRCm39) start gained probably benign
R9162:Tars3 UTSW 7 65,332,518 (GRCm39) missense probably benign 0.01
R9200:Tars3 UTSW 7 65,302,013 (GRCm39) missense probably benign
R9461:Tars3 UTSW 7 65,339,719 (GRCm39) missense possibly damaging 0.68
R9533:Tars3 UTSW 7 65,333,808 (GRCm39) critical splice acceptor site probably null
Z1177:Tars3 UTSW 7 65,302,012 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCACATAGGTGTTGGGGAC -3'
(R):5'- AGACCAGGTCGAAAGTTACTC -3'

Sequencing Primer
(F):5'- CACATAGGTGTTGGGGACTCTCTAC -3'
(R):5'- GACCAGGTCGAAAGTTACTCTCTAAG -3'
Posted On 2014-10-01