Mutagenetix > Incidental Mutation

Incidental Mutation 'R2144:Lrrk1'

236631

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

040147-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2144 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 66296163 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 566 (S566L)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

AlphaFold

Q3UHC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000015277
AA Change: S566L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: S566L

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	G	A	4: 88,868,174	T69I	unknown	Het
4930553M12Rik	T	A	4: 88,868,175	T69S	unknown	Het
Acsl6	A	T	11: 54,341,778	Q485L	probably damaging	Het
Adam5	C	A	8: 24,815,480	V81F	probably benign	Het
Armc4	C	T	18: 7,127,229	E995K	probably damaging	Het
Atp5s	A	G	12: 69,741,054	Q88R	probably damaging	Het
Bag2	A	G	1: 33,746,831	S137P	possibly damaging	Het
Birc6	A	T	17: 74,660,413	Q4103L	possibly damaging	Het
Camta2	A	G	11: 70,671,575	F999L	probably benign	Het
Cap2	A	T	13: 46,560,502		probably null	Het
Ccnk	T	A	12: 108,189,090	L102Q	probably null	Het
Cd52	T	C	4: 134,093,737		probably benign	Het
Cdc123	A	T	2: 5,810,806	I160K	probably benign	Het
Cep85l	T	C	10: 53,358,126	N52S	probably benign	Het
Cntnap5a	C	T	1: 116,101,710	T298I	probably benign	Het
Cpsf4	G	T	5: 145,178,762	S192I	probably benign	Het
Cpxm1	A	G	2: 130,397,410	S33P	probably benign	Het
Cyp2a12	A	T	7: 27,034,769	T376S	possibly damaging	Het
Cyp3a16	A	G	5: 145,456,084	F137S	probably damaging	Het
Des	A	G	1: 75,366,804	T444A	probably benign	Het
Dgcr8	C	T	16: 18,284,256	G54D	probably damaging	Het
Doxl2	A	G	6: 48,975,291	H50R	probably benign	Het
Dsc3	A	G	18: 19,980,686	F393S	possibly damaging	Het
Dstyk	T	A	1: 132,463,375	M838K	probably damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Eml5	A	C	12: 98,810,605	F1417C	probably damaging	Het
Ep400	A	T	5: 110,703,518	M1366K	unknown	Het
Epg5	G	T	18: 77,954,197	C425F	possibly damaging	Het
Epha3	C	G	16: 63,773,317	R136P	possibly damaging	Het
Extl1	C	A	4: 134,371,044	E225D	probably benign	Het
Fam186b	A	G	15: 99,280,657	Y263H	probably benign	Het
Fbn2	A	G	18: 58,052,993	V1761A	possibly damaging	Het
Fer1l6	T	A	15: 58,627,534	M1251K	probably benign	Het
Gart	A	T	16: 91,630,081	I555N	probably damaging	Het
Gm11596	A	T	11: 99,792,963	C110*	probably null	Het
Gnptab	C	T	10: 88,428,506	S262L	possibly damaging	Het
Gpr21	T	C	2: 37,518,231	V263A	probably benign	Het
Gxylt1	T	C	15: 93,254,480	I224V	probably benign	Het
H2-Aa	A	G	17: 34,283,827	S122P	probably damaging	Het
Hsph1	A	C	5: 149,630,337		probably null	Het
Hunk	G	A	16: 90,432,532	D94N	probably damaging	Het
Ikbke	C	A	1: 131,273,474	V176L	probably damaging	Het
Inpp5k	A	T	11: 75,647,191		probably null	Het
Ints10	A	G	8: 68,796,805	T96A	probably damaging	Het
Kansl2	A	T	15: 98,526,631	V306E	probably benign	Het
Kif20a	A	G	18: 34,625,604	D42G	possibly damaging	Het
Klhl7	A	T	5: 24,100,863	M37L	probably benign	Het
Krtap1-5	T	C	11: 99,580,818	I50V	probably benign	Het
Ktn1	A	G	14: 47,714,652	E983G	probably damaging	Het
M6pr	A	G	6: 122,315,367	M174V	probably benign	Het
Man2a2	A	G	7: 80,363,516	S510P	probably damaging	Het
Mmrn1	G	A	6: 60,945,075	S172N	possibly damaging	Het
Mpv17	A	G	5: 31,154,189		probably null	Het
Mrgpra9	T	C	7: 47,235,463	E152G	probably benign	Het
Mst1r	T	C	9: 107,913,168	V660A	probably benign	Het
Myof	A	G	19: 37,981,221		probably null	Het
Myrf	G	A	19: 10,228,674	P126L	probably benign	Het
Nckap1l	C	T	15: 103,475,676	A567V	probably damaging	Het
Nphs1	A	G	7: 30,460,970	E169G	probably benign	Het
Npy1r	T	A	8: 66,705,184	V382D	probably benign	Het
Nrl	A	T	14: 55,520,850	M140K	possibly damaging	Het
Olfr1305	A	G	2: 111,873,423	I144T	probably damaging	Het
Olfr199	C	T	16: 59,216,026	V196M	probably benign	Het
Olfr292	T	A	7: 86,695,280	F275I	probably damaging	Het
Olfr694	A	T	7: 106,688,957	M258K	probably damaging	Het
Olfr924	C	T	9: 38,848,339	T75I	probably damaging	Het
Orc5	T	A	5: 22,547,927	L36F	possibly damaging	Het
Osbpl1a	A	T	18: 12,871,173	S396T	probably benign	Het
Pappa	T	A	4: 65,180,949	Y568*	probably null	Het
Pask	C	T	1: 93,321,297	A794T	probably benign	Het
Pclo	C	T	5: 14,858,752	L5025F	unknown	Het
Pde3a	T	C	6: 141,490,111	V924A	probably benign	Het
Pdpr	A	G	8: 111,118,036	N355S	probably damaging	Het
Pepd	A	T	7: 34,921,418	K36M	probably benign	Het
Pet100	T	G	8: 3,622,355	L14R	probably damaging	Het
Pfkfb2	T	C	1: 130,698,723	T438A	probably benign	Het
Pik3r6	T	A	11: 68,543,611	L546*	probably null	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Plxdc1	T	C	11: 97,934,012	Y339C	probably damaging	Het
Primpol	A	T	8: 46,586,343	M414K	probably damaging	Het
Prol1	A	T	5: 88,328,395	T215S	unknown	Het
Prss22	A	G	17: 23,994,682	Y212H	probably damaging	Het
Ralgapa2	C	A	2: 146,388,604	V1014L	probably damaging	Het
Rap1gap2	G	A	11: 74,425,976	T245M	probably damaging	Het
Rbm26	T	A	14: 105,115,202	R1009*	probably null	Het
Rbm42	A	G	7: 30,641,110	*450Q	probably null	Het
Rere	T	C	4: 150,616,931	V1256A	probably damaging	Het
Rmi1	G	T	13: 58,407,983	L15F	probably damaging	Het
Rnf213	T	C	11: 119,443,690	S3242P	probably damaging	Het
Rtel1	T	A	2: 181,323,706	V167E	probably damaging	Het
Scgb1b2	G	T	7: 31,291,763		probably benign	Het
Sin3b	T	C	8: 72,731,265	L203P	probably damaging	Het
Skint6	T	C	4: 113,236,260	S229G	possibly damaging	Het
Slco1a4	T	C	6: 141,809,378	Y566C	probably damaging	Het
Smgc	T	G	15: 91,844,421	D121E	possibly damaging	Het
Sned1	T	A	1: 93,271,684	F495L	probably damaging	Het
St7	A	T	6: 17,886,007	N52I	possibly damaging	Het
Sycn	C	A	7: 28,541,069	Q54K	probably benign	Het
Syngr4	A	G	7: 45,887,040	V186A	probably benign	Het
Tarsl2	G	A	7: 65,655,791	M254I	possibly damaging	Het
Tcaf2	A	T	6: 42,642,804	H96Q	probably benign	Het
Tcp11l2	T	C	10: 84,613,499	Y443H	probably damaging	Het
Tmem200c	A	T	17: 68,842,249	Q609L	possibly damaging	Het
Tmx3	G	A	18: 90,517,490	G83R	probably damaging	Het
Tpgs2	A	C	18: 25,168,541	V23G	possibly damaging	Het
Trhr	T	C	15: 44,197,183	V33A	probably benign	Het
Trim66	A	T	7: 109,475,113	I647N	probably damaging	Het
Trnt1	A	G	6: 106,778,039	K244E	probably damaging	Het
Tsfm	G	A	10: 127,028,445	Q134*	probably null	Het
Ttll9	A	G	2: 153,003,007	T432A	probably benign	Het
Vmn2r78	C	T	7: 86,954,482	L623F	probably damaging	Het
Wdr55	A	G	18: 36,762,366	N132S	possibly damaging	Het
Wipf2	A	T	11: 98,896,214	R356S	possibly damaging	Het
Wnk1	A	G	6: 119,948,988		probably benign	Het
Zfp260	A	G	7: 30,105,340	K222E	probably damaging	Het
Zfp300	A	G	X: 21,081,951	S525P	possibly damaging	Het
Zfp592	A	G	7: 81,038,202	T959A	probably benign	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
R9625:Lrrk1	UTSW	7	66259918	makesense	probably null
R9721:Lrrk1	UTSW	7	66274875	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TCACGGATGTAGCTGTCTCC -3'
(R):5'- ACAGCCCTTTGTATAGCACC -3'

Sequencing Primer
(F):5'- GGATGTAGCTGTCTCCTCACTG -3'
(R):5'- TTGTATAGCACCTCCACACTACGG -3'

Posted On

2014-10-01