Incidental Mutation 'R2144:Lrrk1'
ID236631
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission 040147-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2144 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66296163 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 566 (S566L)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277]
Predicted Effect probably damaging
Transcript: ENSMUST00000015277
AA Change: S566L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: S566L

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Acsl6 A T 11: 54,341,778 Q485L probably damaging Het
Adam5 C A 8: 24,815,480 V81F probably benign Het
Armc4 C T 18: 7,127,229 E995K probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Cap2 A T 13: 46,560,502 probably null Het
Ccnk T A 12: 108,189,090 L102Q probably null Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdc123 A T 2: 5,810,806 I160K probably benign Het
Cep85l T C 10: 53,358,126 N52S probably benign Het
Cntnap5a C T 1: 116,101,710 T298I probably benign Het
Cpsf4 G T 5: 145,178,762 S192I probably benign Het
Cpxm1 A G 2: 130,397,410 S33P probably benign Het
Cyp2a12 A T 7: 27,034,769 T376S possibly damaging Het
Cyp3a16 A G 5: 145,456,084 F137S probably damaging Het
Des A G 1: 75,366,804 T444A probably benign Het
Dgcr8 C T 16: 18,284,256 G54D probably damaging Het
Doxl2 A G 6: 48,975,291 H50R probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Ep400 A T 5: 110,703,518 M1366K unknown Het
Epg5 G T 18: 77,954,197 C425F possibly damaging Het
Epha3 C G 16: 63,773,317 R136P possibly damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fam186b A G 15: 99,280,657 Y263H probably benign Het
Fbn2 A G 18: 58,052,993 V1761A possibly damaging Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Gart A T 16: 91,630,081 I555N probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gnptab C T 10: 88,428,506 S262L possibly damaging Het
Gpr21 T C 2: 37,518,231 V263A probably benign Het
Gxylt1 T C 15: 93,254,480 I224V probably benign Het
H2-Aa A G 17: 34,283,827 S122P probably damaging Het
Hsph1 A C 5: 149,630,337 probably null Het
Hunk G A 16: 90,432,532 D94N probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Ints10 A G 8: 68,796,805 T96A probably damaging Het
Kansl2 A T 15: 98,526,631 V306E probably benign Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Ktn1 A G 14: 47,714,652 E983G probably damaging Het
M6pr A G 6: 122,315,367 M174V probably benign Het
Man2a2 A G 7: 80,363,516 S510P probably damaging Het
Mmrn1 G A 6: 60,945,075 S172N possibly damaging Het
Mpv17 A G 5: 31,154,189 probably null Het
Mrgpra9 T C 7: 47,235,463 E152G probably benign Het
Mst1r T C 9: 107,913,168 V660A probably benign Het
Myof A G 19: 37,981,221 probably null Het
Myrf G A 19: 10,228,674 P126L probably benign Het
Nckap1l C T 15: 103,475,676 A567V probably damaging Het
Nphs1 A G 7: 30,460,970 E169G probably benign Het
Npy1r T A 8: 66,705,184 V382D probably benign Het
Nrl A T 14: 55,520,850 M140K possibly damaging Het
Olfr1305 A G 2: 111,873,423 I144T probably damaging Het
Olfr199 C T 16: 59,216,026 V196M probably benign Het
Olfr292 T A 7: 86,695,280 F275I probably damaging Het
Olfr694 A T 7: 106,688,957 M258K probably damaging Het
Olfr924 C T 9: 38,848,339 T75I probably damaging Het
Orc5 T A 5: 22,547,927 L36F possibly damaging Het
Osbpl1a A T 18: 12,871,173 S396T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pclo C T 5: 14,858,752 L5025F unknown Het
Pde3a T C 6: 141,490,111 V924A probably benign Het
Pdpr A G 8: 111,118,036 N355S probably damaging Het
Pepd A T 7: 34,921,418 K36M probably benign Het
Pet100 T G 8: 3,622,355 L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pik3r6 T A 11: 68,543,611 L546* probably null Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Primpol A T 8: 46,586,343 M414K probably damaging Het
Prol1 A T 5: 88,328,395 T215S unknown Het
Prss22 A G 17: 23,994,682 Y212H probably damaging Het
Ralgapa2 C A 2: 146,388,604 V1014L probably damaging Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rbm26 T A 14: 105,115,202 R1009* probably null Het
Rbm42 A G 7: 30,641,110 *450Q probably null Het
Rere T C 4: 150,616,931 V1256A probably damaging Het
Rmi1 G T 13: 58,407,983 L15F probably damaging Het
Rnf213 T C 11: 119,443,690 S3242P probably damaging Het
Rtel1 T A 2: 181,323,706 V167E probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Sin3b T C 8: 72,731,265 L203P probably damaging Het
Skint6 T C 4: 113,236,260 S229G possibly damaging Het
Slco1a4 T C 6: 141,809,378 Y566C probably damaging Het
Smgc T G 15: 91,844,421 D121E possibly damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
St7 A T 6: 17,886,007 N52I possibly damaging Het
Sycn C A 7: 28,541,069 Q54K probably benign Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tcaf2 A T 6: 42,642,804 H96Q probably benign Het
Tcp11l2 T C 10: 84,613,499 Y443H probably damaging Het
Tmem200c A T 17: 68,842,249 Q609L possibly damaging Het
Tmx3 G A 18: 90,517,490 G83R probably damaging Het
Tpgs2 A C 18: 25,168,541 V23G possibly damaging Het
Trhr T C 15: 44,197,183 V33A probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Trnt1 A G 6: 106,778,039 K244E probably damaging Het
Tsfm G A 10: 127,028,445 Q134* probably null Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vmn2r78 C T 7: 86,954,482 L623F probably damaging Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Wnk1 A G 6: 119,948,988 probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp592 A G 7: 81,038,202 T959A probably benign Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
Savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3893:Lrrk1 UTSW 7 66278520 splice site probably benign
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 66262293 missense probably benign
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 66307107 missense probably benign 0.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 66262133 missense probably benign
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6447:Lrrk1 UTSW 7 66302728 missense probably benign 0.19
R6478:Lrrk1 UTSW 7 66262733 missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
R7593:Lrrk1 UTSW 7 66308691 missense probably benign 0.12
R7728:Lrrk1 UTSW 7 66262715 missense probably benign 0.00
R7993:Lrrk1 UTSW 7 66262454 missense probably benign 0.00
R8009:Lrrk1 UTSW 7 66265474 missense possibly damaging 0.82
R8037:Lrrk1 UTSW 7 66285341 missense probably benign
R8101:Lrrk1 UTSW 7 66342782 missense probably benign
R8116:Lrrk1 UTSW 7 66262623 missense possibly damaging 0.95
R8126:Lrrk1 UTSW 7 66292315 missense probably damaging 1.00
R8278:Lrrk1 UTSW 7 66278684 missense probably benign 0.37
RF018:Lrrk1 UTSW 7 66381502 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCACGGATGTAGCTGTCTCC -3'
(R):5'- ACAGCCCTTTGTATAGCACC -3'

Sequencing Primer
(F):5'- GGATGTAGCTGTCTCCTCACTG -3'
(R):5'- TTGTATAGCACCTCCACACTACGG -3'
Posted On2014-10-01