Incidental Mutation 'R0201:Mboat1'
ID23665
Institutional Source Beutler Lab
Gene Symbol Mboat1
Ensembl Gene ENSMUSG00000038732
Gene Namemembrane bound O-acyltransferase domain containing 1
Synonyms9130215M02Rik, Oact1
MMRRC Submission 038458-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0201 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location30136489-30246717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30202375 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 124 (R124H)
Ref Sequence ENSEMBL: ENSMUSP00000045441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047311]
Predicted Effect probably benign
Transcript: ENSMUST00000047311
AA Change: R124H

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045441
Gene: ENSMUSG00000038732
AA Change: R124H

DomainStartEndE-ValueType
Pfam:MBOAT 36 438 4.8e-29 PFAM
transmembrane domain 455 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152798
SMART Domains Protein: ENSMUSP00000121195
Gene: ENSMUSG00000038732

DomainStartEndE-ValueType
Pfam:MBOAT 9 209 1.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220870
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the membrane-bound O-acetyltransferase superfamily. The encoded transmembrane protein is an enzyme that transfers organic compounds, preferably from oleoyl-CoA, to hydroxyl groups of protein targets in membranes. A translocation disrupting this gene may be associated with brachydactyly syndactyly syndrome. Alternately spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,581,957 probably null Het
Adamts16 T A 13: 70,779,644 Q492L possibly damaging Het
Aplnr A G 2: 85,137,177 D182G probably damaging Het
Arnt2 G T 7: 84,361,659 S3* probably null Het
Asxl3 T C 18: 22,523,154 V1407A probably benign Het
Atg13 A T 2: 91,684,762 probably null Het
Atm A T 9: 53,454,279 probably benign Het
Birc6 T G 17: 74,609,327 V1746G possibly damaging Het
Cbln1 G T 8: 87,472,113 T43K probably benign Het
Cbx5 T C 15: 103,199,700 T173A probably damaging Het
Cc2d2a A G 5: 43,737,512 Y1437C probably damaging Het
Ccdc78 C A 17: 25,789,236 probably benign Het
Cd2bp2 A G 7: 127,193,828 Y341H probably damaging Het
Cdhr5 T A 7: 141,276,378 D88V probably damaging Het
Ces1f T A 8: 93,267,329 T275S probably null Het
Clca4a T C 3: 144,960,717 N458S probably benign Het
Cog5 A G 12: 31,839,841 K521R probably damaging Het
Csf2ra T A 19: 61,225,568 T305S probably benign Het
Csmd3 T A 15: 47,619,729 probably benign Het
Cts6 T A 13: 61,201,499 R132* probably null Het
D5Ertd579e G T 5: 36,616,465 N195K probably damaging Het
Ddx1 A G 12: 13,223,808 V606A probably damaging Het
Dip2b G A 15: 100,186,147 D884N probably damaging Het
Ehhadh A G 16: 21,773,493 probably null Het
Enpp1 T A 10: 24,653,917 T608S probably benign Het
Fancm T C 12: 65,101,632 Y674H probably damaging Het
Fat4 T A 3: 38,891,596 V1546D probably damaging Het
Fsd1 G A 17: 55,990,522 A158T probably benign Het
Fzd2 T A 11: 102,606,122 M464K probably damaging Het
Gjc2 A G 11: 59,177,590 F22S possibly damaging Het
Gm13101 T C 4: 143,964,890 E421G probably damaging Het
Gria2 T C 3: 80,707,838 Y445C probably damaging Het
Hsdl1 T A 8: 119,566,256 I147F possibly damaging Het
Ifi44 T C 3: 151,745,636 Y226C probably damaging Het
Il16 A G 7: 83,722,308 C97R probably damaging Het
Impg1 A T 9: 80,345,561 S369T probably damaging Het
Jmjd1c A G 10: 67,219,109 T390A unknown Het
Lgi1 A G 19: 38,301,293 E269G possibly damaging Het
Lrp6 G T 6: 134,450,897 Y1577* probably null Het
Lrrc74a G T 12: 86,761,773 probably benign Het
Man1c1 A T 4: 134,640,398 probably null Het
Map1lc3b A C 8: 121,590,550 Q9P possibly damaging Het
Mcu A G 10: 59,456,677 L60P probably damaging Het
Mrs2 G T 13: 25,018,534 Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Neb G A 2: 52,206,878 probably benign Het
Nlrp2 C T 7: 5,328,329 G356D probably benign Het
Notch3 A G 17: 32,156,148 probably benign Het
Npr2 A C 4: 43,641,617 S474R probably damaging Het
Nupl1 A G 14: 60,244,616 F100L probably benign Het
Osbpl6 A C 2: 76,546,042 D87A possibly damaging Het
Pabpc2 A T 18: 39,775,307 M542L probably benign Het
Papln A G 12: 83,783,027 probably benign Het
Parpbp T C 10: 88,092,896 I561V possibly damaging Het
Pcdhb13 C T 18: 37,442,581 A4V probably benign Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Poldip3 T A 15: 83,135,296 M182L probably benign Het
Por T C 5: 135,731,178 S240P possibly damaging Het
Pramef20 A T 4: 144,377,273 probably benign Het
Prss22 A T 17: 23,996,301 V167D probably damaging Het
Prss37 A C 6: 40,516,349 L61R probably damaging Het
Psmd1 C T 1: 86,118,616 T702M probably benign Het
Pxdn G T 12: 30,002,431 G869V possibly damaging Het
Rabgap1l A G 1: 160,453,745 probably benign Het
Rapgef6 T C 11: 54,619,941 V228A probably damaging Het
Rnf169 T C 7: 99,926,003 R462G possibly damaging Het
Rnft2 A G 5: 118,194,680 probably benign Het
Sgo2b T C 8: 63,926,636 D1054G probably benign Het
Sh3bgr T C 16: 96,228,517 probably benign Het
Slc12a4 A G 8: 105,945,350 V910A possibly damaging Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Spty2d1 G A 7: 46,997,901 R427* probably null Het
Ssc5d A G 7: 4,944,663 T1339A probably benign Het
Sspo A C 6: 48,455,752 E854A possibly damaging Het
Stx7 A G 10: 24,185,079 probably benign Het
Styk1 A T 6: 131,301,730 probably benign Het
Tex33 T A 15: 78,378,828 M209L probably damaging Het
Tmem163 T G 1: 127,668,637 probably benign Het
Tmppe C CT 9: 114,404,639 probably null Het
Tmx2 A G 2: 84,673,082 V229A probably benign Het
Top2b T C 14: 16,383,174 L54P probably damaging Het
Trim62 A T 4: 128,902,550 Y280F probably benign Het
Tssk4 A T 14: 55,651,559 K181* probably null Het
Tssk4 A T 14: 55,651,560 K181M probably damaging Het
Ubn1 A G 16: 5,064,614 D313G probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Other mutations in Mboat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Mboat1 APN 13 30195793 splice site probably benign
IGL01331:Mboat1 APN 13 30219701 splice site probably benign
IGL01837:Mboat1 APN 13 30241183 missense possibly damaging 0.72
IGL02070:Mboat1 APN 13 30224397 missense probably benign 0.02
IGL03338:Mboat1 APN 13 30136759 missense probably benign 0.01
langsat UTSW 13 30202375 missense probably benign 0.37
R0322:Mboat1 UTSW 13 30232080 splice site probably benign
R0448:Mboat1 UTSW 13 30202410 missense probably damaging 1.00
R1793:Mboat1 UTSW 13 30219650 missense probably damaging 0.99
R2040:Mboat1 UTSW 13 30241317 critical splice donor site probably null
R3054:Mboat1 UTSW 13 30195741 missense probably benign
R3122:Mboat1 UTSW 13 30238048 missense probably damaging 1.00
R4948:Mboat1 UTSW 13 30241230 missense probably damaging 1.00
R4958:Mboat1 UTSW 13 30224393 missense probably damaging 1.00
R4992:Mboat1 UTSW 13 30202360 missense possibly damaging 0.80
R5429:Mboat1 UTSW 13 30219667 missense probably benign 0.02
R5862:Mboat1 UTSW 13 30235697 missense probably damaging 1.00
R6025:Mboat1 UTSW 13 30224526 missense probably benign
R6352:Mboat1 UTSW 13 30202420 missense possibly damaging 0.59
R6956:Mboat1 UTSW 13 30238076 missense possibly damaging 0.89
R7088:Mboat1 UTSW 13 30195789 critical splice donor site probably null
R7165:Mboat1 UTSW 13 30224415 missense probably damaging 1.00
R7366:Mboat1 UTSW 13 30202362 missense possibly damaging 0.94
R7727:Mboat1 UTSW 13 30226306 missense probably benign 0.00
Z1177:Mboat1 UTSW 13 30226378 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGATGTGGCTGGACCACTCAAAAC -3'
(R):5'- AGTGACTGCGGACAAGGCATAATC -3'

Sequencing Primer
(F):5'- GCTGGACCACTCAAAACTTTGTG -3'
(R):5'- TGCCTAACTCTGTTCCAAGAAG -3'
Posted On2013-04-16