Mutagenetix > Incidental Mutations

Incidental Mutation 'R2144:Gnptab'

236651

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

040147-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R2144 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 88428506 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 262 (S262L)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020251
AA Change: S262L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: S262L

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132738

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141343

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	G	A	4: 88,868,174	T69I	unknown	Het
4930553M12Rik	T	A	4: 88,868,175	T69S	unknown	Het
Acsl6	A	T	11: 54,341,778	Q485L	probably damaging	Het
Adam5	C	A	8: 24,815,480	V81F	probably benign	Het
Armc4	C	T	18: 7,127,229	E995K	probably damaging	Het
Atp5s	A	G	12: 69,741,054	Q88R	probably damaging	Het
Bag2	A	G	1: 33,746,831	S137P	possibly damaging	Het
Birc6	A	T	17: 74,660,413	Q4103L	possibly damaging	Het
Camta2	A	G	11: 70,671,575	F999L	probably benign	Het
Cap2	A	T	13: 46,560,502		probably null	Het
Ccnk	T	A	12: 108,189,090	L102Q	probably null	Het
Cd52	T	C	4: 134,093,737		probably benign	Het
Cdc123	A	T	2: 5,810,806	I160K	probably benign	Het
Cep85l	T	C	10: 53,358,126	N52S	probably benign	Het
Cntnap5a	C	T	1: 116,101,710	T298I	probably benign	Het
Cpsf4	G	T	5: 145,178,762	S192I	probably benign	Het
Cpxm1	A	G	2: 130,397,410	S33P	probably benign	Het
Cyp2a12	A	T	7: 27,034,769	T376S	possibly damaging	Het
Cyp3a16	A	G	5: 145,456,084	F137S	probably damaging	Het
Des	A	G	1: 75,366,804	T444A	probably benign	Het
Dgcr8	C	T	16: 18,284,256	G54D	probably damaging	Het
Doxl2	A	G	6: 48,975,291	H50R	probably benign	Het
Dsc3	A	G	18: 19,980,686	F393S	possibly damaging	Het
Dstyk	T	A	1: 132,463,375	M838K	probably damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Eml5	A	C	12: 98,810,605	F1417C	probably damaging	Het
Ep400	A	T	5: 110,703,518	M1366K	unknown	Het
Epg5	G	T	18: 77,954,197	C425F	possibly damaging	Het
Epha3	C	G	16: 63,773,317	R136P	possibly damaging	Het
Extl1	C	A	4: 134,371,044	E225D	probably benign	Het
Fam186b	A	G	15: 99,280,657	Y263H	probably benign	Het
Fbn2	A	G	18: 58,052,993	V1761A	possibly damaging	Het
Fer1l6	T	A	15: 58,627,534	M1251K	probably benign	Het
Gart	A	T	16: 91,630,081	I555N	probably damaging	Het
Gm11596	A	T	11: 99,792,963	C110*	probably null	Het
Gpr21	T	C	2: 37,518,231	V263A	probably benign	Het
Gxylt1	T	C	15: 93,254,480	I224V	probably benign	Het
H2-Aa	A	G	17: 34,283,827	S122P	probably damaging	Het
Hsph1	A	C	5: 149,630,337		probably null	Het
Hunk	G	A	16: 90,432,532	D94N	probably damaging	Het
Ikbke	C	A	1: 131,273,474	V176L	probably damaging	Het
Inpp5k	A	T	11: 75,647,191		probably null	Het
Ints10	A	G	8: 68,796,805	T96A	probably damaging	Het
Kansl2	A	T	15: 98,526,631	V306E	probably benign	Het
Kif20a	A	G	18: 34,625,604	D42G	possibly damaging	Het
Klhl7	A	T	5: 24,100,863	M37L	probably benign	Het
Krtap1-5	T	C	11: 99,580,818	I50V	probably benign	Het
Ktn1	A	G	14: 47,714,652	E983G	probably damaging	Het
Lrrk1	G	A	7: 66,296,163	S566L	probably damaging	Het
M6pr	A	G	6: 122,315,367	M174V	probably benign	Het
Man2a2	A	G	7: 80,363,516	S510P	probably damaging	Het
Mmrn1	G	A	6: 60,945,075	S172N	possibly damaging	Het
Mpv17	A	G	5: 31,154,189		probably null	Het
Mrgpra9	T	C	7: 47,235,463	E152G	probably benign	Het
Mst1r	T	C	9: 107,913,168	V660A	probably benign	Het
Myof	A	G	19: 37,981,221		probably null	Het
Myrf	G	A	19: 10,228,674	P126L	probably benign	Het
Nckap1l	C	T	15: 103,475,676	A567V	probably damaging	Het
Nphs1	A	G	7: 30,460,970	E169G	probably benign	Het
Npy1r	T	A	8: 66,705,184	V382D	probably benign	Het
Nrl	A	T	14: 55,520,850	M140K	possibly damaging	Het
Olfr1305	A	G	2: 111,873,423	I144T	probably damaging	Het
Olfr199	C	T	16: 59,216,026	V196M	probably benign	Het
Olfr292	T	A	7: 86,695,280	F275I	probably damaging	Het
Olfr694	A	T	7: 106,688,957	M258K	probably damaging	Het
Olfr924	C	T	9: 38,848,339	T75I	probably damaging	Het
Orc5	T	A	5: 22,547,927	L36F	possibly damaging	Het
Osbpl1a	A	T	18: 12,871,173	S396T	probably benign	Het
Pappa	T	A	4: 65,180,949	Y568*	probably null	Het
Pask	C	T	1: 93,321,297	A794T	probably benign	Het
Pclo	C	T	5: 14,858,752	L5025F	unknown	Het
Pde3a	T	C	6: 141,490,111	V924A	probably benign	Het
Pdpr	A	G	8: 111,118,036	N355S	probably damaging	Het
Pepd	A	T	7: 34,921,418	K36M	probably benign	Het
Pet100	T	G	8: 3,622,355	L14R	probably damaging	Het
Pfkfb2	T	C	1: 130,698,723	T438A	probably benign	Het
Pik3r6	T	A	11: 68,543,611	L546*	probably null	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Plxdc1	T	C	11: 97,934,012	Y339C	probably damaging	Het
Primpol	A	T	8: 46,586,343	M414K	probably damaging	Het
Prol1	A	T	5: 88,328,395	T215S	unknown	Het
Prss22	A	G	17: 23,994,682	Y212H	probably damaging	Het
Ralgapa2	C	A	2: 146,388,604	V1014L	probably damaging	Het
Rap1gap2	G	A	11: 74,425,976	T245M	probably damaging	Het
Rbm26	T	A	14: 105,115,202	R1009*	probably null	Het
Rbm42	A	G	7: 30,641,110	*450Q	probably null	Het
Rere	T	C	4: 150,616,931	V1256A	probably damaging	Het
Rmi1	G	T	13: 58,407,983	L15F	probably damaging	Het
Rnf213	T	C	11: 119,443,690	S3242P	probably damaging	Het
Rtel1	T	A	2: 181,323,706	V167E	probably damaging	Het
Scgb1b2	G	T	7: 31,291,763		probably benign	Het
Sin3b	T	C	8: 72,731,265	L203P	probably damaging	Het
Skint6	T	C	4: 113,236,260	S229G	possibly damaging	Het
Slco1a4	T	C	6: 141,809,378	Y566C	probably damaging	Het
Smgc	T	G	15: 91,844,421	D121E	possibly damaging	Het
Sned1	T	A	1: 93,271,684	F495L	probably damaging	Het
St7	A	T	6: 17,886,007	N52I	possibly damaging	Het
Sycn	C	A	7: 28,541,069	Q54K	probably benign	Het
Syngr4	A	G	7: 45,887,040	V186A	probably benign	Het
Tarsl2	G	A	7: 65,655,791	M254I	possibly damaging	Het
Tcaf2	A	T	6: 42,642,804	H96Q	probably benign	Het
Tcp11l2	T	C	10: 84,613,499	Y443H	probably damaging	Het
Tmem200c	A	T	17: 68,842,249	Q609L	possibly damaging	Het
Tmx3	G	A	18: 90,517,490	G83R	probably damaging	Het
Tpgs2	A	C	18: 25,168,541	V23G	possibly damaging	Het
Trhr	T	C	15: 44,197,183	V33A	probably benign	Het
Trim66	A	T	7: 109,475,113	I647N	probably damaging	Het
Trnt1	A	G	6: 106,778,039	K244E	probably damaging	Het
Tsfm	G	A	10: 127,028,445	Q134*	probably null	Het
Ttll9	A	G	2: 153,003,007	T432A	probably benign	Het
Vmn2r78	C	T	7: 86,954,482	L623F	probably damaging	Het
Wdr55	A	G	18: 36,762,366	N132S	possibly damaging	Het
Wipf2	A	T	11: 98,896,214	R356S	possibly damaging	Het
Wnk1	A	G	6: 119,948,988		probably benign	Het
Zfp260	A	G	7: 30,105,340	K222E	probably damaging	Het
Zfp300	A	G	X: 21,081,951	S525P	possibly damaging	Het
Zfp592	A	G	7: 81,038,202	T959A	probably benign	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8219:Gnptab	UTSW	10	88433792	missense	probably benign
R8221:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8313:Gnptab	UTSW	10	88439209	missense	probably damaging	1.00
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGTGAAACTGTCTTTATGTGTC -3'
(R):5'- ACTCTGAGTCCTTGACCTGG -3'

Sequencing Primer
(F):5'- ACACCTGTATGATCTCAGCATTGGG -3'
(R):5'- AGTCCTTGACCTGGGCTGAAG -3'

Posted On

2014-10-01