Incidental Mutation 'R2144:Camta2'
ID 236655
Institutional Source Beutler Lab
Gene Symbol Camta2
Ensembl Gene ENSMUSG00000040712
Gene Name calmodulin binding transcription activator 2
Synonyms Kiaa0909-hp
MMRRC Submission 040147-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.496) question?
Stock # R2144 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70560289-70578931 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70562401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 999 (F999L)
Ref Sequence ENSEMBL: ENSMUSP00000104185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000036299] [ENSMUST00000100933] [ENSMUST00000108544] [ENSMUST00000108545] [ENSMUST00000119120] [ENSMUST00000120261] [ENSMUST00000129434] [ENSMUST00000145823]
AlphaFold Q80Y50
Predicted Effect probably benign
Transcript: ENSMUST00000018431
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036299
AA Change: F1028L

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043792
Gene: ENSMUSG00000040712
AA Change: F1028L

DomainStartEndE-ValueType
CG-1 34 155 1.07e-83 SMART
low complexity region 232 243 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 417 435 N/A INTRINSIC
low complexity region 461 485 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Pfam:TIG 541 621 6.2e-13 PFAM
low complexity region 660 679 N/A INTRINSIC
Blast:ANK 717 750 7e-12 BLAST
SCOP:d1myo__ 718 816 2e-15 SMART
Blast:ANK 762 792 4e-11 BLAST
low complexity region 829 839 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
IQ 1053 1075 2.59e2 SMART
IQ 1076 1092 2.38e2 SMART
IQ 1106 1128 5.42e0 SMART
low complexity region 1140 1157 N/A INTRINSIC
low complexity region 1180 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100933
AA Change: F1025L

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098493
Gene: ENSMUSG00000040712
AA Change: F1025L

DomainStartEndE-ValueType
CG-1 36 152 8.08e-88 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
low complexity region 458 482 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:TIG 538 618 1.2e-8 PFAM
low complexity region 657 676 N/A INTRINSIC
Blast:ANK 714 747 8e-12 BLAST
SCOP:d1myo__ 715 813 2e-15 SMART
Blast:ANK 759 789 4e-11 BLAST
low complexity region 826 836 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 858 879 N/A INTRINSIC
IQ 1050 1072 2.59e2 SMART
IQ 1073 1095 1.18e1 SMART
IQ 1096 1118 5.42e0 SMART
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1170 1180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108544
AA Change: F1023L

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104184
Gene: ENSMUSG00000040712
AA Change: F1023L

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.2e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 4e-11 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1087 2.38e2 SMART
IQ 1101 1123 5.42e0 SMART
low complexity region 1135 1152 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108545
AA Change: F999L

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104185
Gene: ENSMUSG00000040712
AA Change: F999L

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1.1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 5e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1069 1.18e1 SMART
IQ 1070 1092 5.42e0 SMART
low complexity region 1104 1121 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119120
AA Change: F1023L

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113847
Gene: ENSMUSG00000040712
AA Change: F1023L

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.1e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 8e-13 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1093 1.18e1 SMART
IQ 1094 1116 5.42e0 SMART
low complexity region 1128 1145 N/A INTRINSIC
low complexity region 1168 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125687
Predicted Effect probably benign
Transcript: ENSMUST00000120261
AA Change: F999L

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113667
Gene: ENSMUSG00000040712
AA Change: F999L

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 7e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1063 2.38e2 SMART
IQ 1077 1099 5.42e0 SMART
low complexity region 1111 1128 N/A INTRINSIC
low complexity region 1151 1161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124691
Predicted Effect probably benign
Transcript: ENSMUST00000129434
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145823
SMART Domains Protein: ENSMUSP00000123602
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 137 2.55e-44 SMART
low complexity region 146 165 N/A INTRINSIC
Meta Mutation Damage Score 0.1653 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the calmodulin-binding transcription activator protein family. Members of this family share a common domain structure that consists of a transcription activation domain, a DNA-binding domain, and a calmodulin-binding domain. The encoded protein may be a transcriptional coactivator of genes involved in cardiac growth. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious cardiac defects, but show reduced pathophysiologic cardiac hypertrophy in response to diverse stress stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,412 (GRCm39) T69S unknown Het
4930553M12Rik G A 4: 88,786,411 (GRCm39) T69I unknown Het
Acsl6 A T 11: 54,232,604 (GRCm39) Q485L probably damaging Het
Adam5 C A 8: 25,305,496 (GRCm39) V81F probably benign Het
Aoc1l1 A G 6: 48,952,225 (GRCm39) H50R probably benign Het
Bag2 A G 1: 33,785,912 (GRCm39) S137P possibly damaging Het
Birc6 A T 17: 74,967,408 (GRCm39) Q4103L possibly damaging Het
Cap2 A T 13: 46,713,978 (GRCm39) probably null Het
Ccnk T A 12: 108,155,349 (GRCm39) L102Q probably null Het
Cd52 T C 4: 133,821,048 (GRCm39) probably benign Het
Cdc123 A T 2: 5,815,617 (GRCm39) I160K probably benign Het
Cep85l T C 10: 53,234,222 (GRCm39) N52S probably benign Het
Cntnap5a C T 1: 116,029,440 (GRCm39) T298I probably benign Het
Cpsf4 G T 5: 145,115,572 (GRCm39) S192I probably benign Het
Cpxm1 A G 2: 130,239,330 (GRCm39) S33P probably benign Het
Cyp2a12 A T 7: 26,734,194 (GRCm39) T376S possibly damaging Het
Cyp3a16 A G 5: 145,392,894 (GRCm39) F137S probably damaging Het
Des A G 1: 75,343,448 (GRCm39) T444A probably benign Het
Dgcr8 C T 16: 18,102,120 (GRCm39) G54D probably damaging Het
Dmac2l A G 12: 69,787,828 (GRCm39) Q88R probably damaging Het
Dsc3 A G 18: 20,113,743 (GRCm39) F393S possibly damaging Het
Dstyk T A 1: 132,391,113 (GRCm39) M838K probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Eml5 A C 12: 98,776,864 (GRCm39) F1417C probably damaging Het
Ep400 A T 5: 110,851,384 (GRCm39) M1366K unknown Het
Epg5 G T 18: 77,997,412 (GRCm39) C425F possibly damaging Het
Epha3 C G 16: 63,593,680 (GRCm39) R136P possibly damaging Het
Extl1 C A 4: 134,098,355 (GRCm39) E225D probably benign Het
Fam186b A G 15: 99,178,538 (GRCm39) Y263H probably benign Het
Fbn2 A G 18: 58,186,065 (GRCm39) V1761A possibly damaging Het
Fer1l6 T A 15: 58,499,383 (GRCm39) M1251K probably benign Het
Gart A T 16: 91,426,969 (GRCm39) I555N probably damaging Het
Gm11596 A T 11: 99,683,789 (GRCm39) C110* probably null Het
Gnptab C T 10: 88,264,368 (GRCm39) S262L possibly damaging Het
Gpr21 T C 2: 37,408,243 (GRCm39) V263A probably benign Het
Gxylt1 T C 15: 93,152,361 (GRCm39) I224V probably benign Het
H2-Aa A G 17: 34,502,801 (GRCm39) S122P probably damaging Het
Hsph1 A C 5: 149,553,802 (GRCm39) probably null Het
Hunk G A 16: 90,229,420 (GRCm39) D94N probably damaging Het
Ikbke C A 1: 131,201,211 (GRCm39) V176L probably damaging Het
Inpp5k A T 11: 75,538,017 (GRCm39) probably null Het
Ints10 A G 8: 69,249,457 (GRCm39) T96A probably damaging Het
Kansl2 A T 15: 98,424,512 (GRCm39) V306E probably benign Het
Kif20a A G 18: 34,758,657 (GRCm39) D42G possibly damaging Het
Klhl7 A T 5: 24,305,861 (GRCm39) M37L probably benign Het
Krtap1-5 T C 11: 99,471,644 (GRCm39) I50V probably benign Het
Ktn1 A G 14: 47,952,109 (GRCm39) E983G probably damaging Het
Lrrk1 G A 7: 65,945,911 (GRCm39) S566L probably damaging Het
M6pr A G 6: 122,292,326 (GRCm39) M174V probably benign Het
Man2a2 A G 7: 80,013,264 (GRCm39) S510P probably damaging Het
Mmrn1 G A 6: 60,922,059 (GRCm39) S172N possibly damaging Het
Mpv17 A G 5: 31,311,533 (GRCm39) probably null Het
Mrgpra9 T C 7: 46,885,211 (GRCm39) E152G probably benign Het
Mst1r T C 9: 107,790,367 (GRCm39) V660A probably benign Het
Myof A G 19: 37,969,669 (GRCm39) probably null Het
Myrf G A 19: 10,206,038 (GRCm39) P126L probably benign Het
Nckap1l C T 15: 103,384,103 (GRCm39) A567V probably damaging Het
Nphs1 A G 7: 30,160,395 (GRCm39) E169G probably benign Het
Npy1r T A 8: 67,157,836 (GRCm39) V382D probably benign Het
Nrl A T 14: 55,758,307 (GRCm39) M140K possibly damaging Het
Odad2 C T 18: 7,127,229 (GRCm39) E995K probably damaging Het
Or14c39 T A 7: 86,344,488 (GRCm39) F275I probably damaging Het
Or2ag1b A T 7: 106,288,164 (GRCm39) M258K probably damaging Het
Or4f56 A G 2: 111,703,768 (GRCm39) I144T probably damaging Het
Or5ac17 C T 16: 59,036,389 (GRCm39) V196M probably benign Het
Or8d2 C T 9: 38,759,635 (GRCm39) T75I probably damaging Het
Orc5 T A 5: 22,752,925 (GRCm39) L36F possibly damaging Het
Osbpl1a A T 18: 13,004,230 (GRCm39) S396T probably benign Het
Pappa T A 4: 65,099,186 (GRCm39) Y568* probably null Het
Pask C T 1: 93,249,019 (GRCm39) A794T probably benign Het
Pclo C T 5: 14,908,766 (GRCm39) L5025F unknown Het
Pde3a T C 6: 141,435,837 (GRCm39) V924A probably benign Het
Pdpr A G 8: 111,844,668 (GRCm39) N355S probably damaging Het
Pepd A T 7: 34,620,843 (GRCm39) K36M probably benign Het
Pet100 T G 8: 3,672,355 (GRCm39) L14R probably damaging Het
Pfkfb2 T C 1: 130,626,460 (GRCm39) T438A probably benign Het
Pik3r6 T A 11: 68,434,437 (GRCm39) L546* probably null Het
Pira2 A T 7: 3,847,344 (GRCm39) L115Q probably damaging Het
Plxdc1 T C 11: 97,824,838 (GRCm39) Y339C probably damaging Het
Primpol A T 8: 47,039,378 (GRCm39) M414K probably damaging Het
Prol1 A T 5: 88,476,254 (GRCm39) T215S unknown Het
Prss22 A G 17: 24,213,656 (GRCm39) Y212H probably damaging Het
Ralgapa2 C A 2: 146,230,524 (GRCm39) V1014L probably damaging Het
Rap1gap2 G A 11: 74,316,802 (GRCm39) T245M probably damaging Het
Rbm26 T A 14: 105,352,638 (GRCm39) R1009* probably null Het
Rbm42 A G 7: 30,340,535 (GRCm39) *450Q probably null Het
Rere T C 4: 150,701,388 (GRCm39) V1256A probably damaging Het
Rmi1 G T 13: 58,555,797 (GRCm39) L15F probably damaging Het
Rnf213 T C 11: 119,334,516 (GRCm39) S3242P probably damaging Het
Rtel1 T A 2: 180,965,499 (GRCm39) V167E probably damaging Het
Scgb1b2 G T 7: 30,991,188 (GRCm39) probably benign Het
Sin3b T C 8: 73,457,893 (GRCm39) L203P probably damaging Het
Skint6 T C 4: 113,093,457 (GRCm39) S229G possibly damaging Het
Slco1a4 T C 6: 141,755,104 (GRCm39) Y566C probably damaging Het
Smgc T G 15: 91,728,624 (GRCm39) D121E possibly damaging Het
Sned1 T A 1: 93,199,406 (GRCm39) F495L probably damaging Het
St7 A T 6: 17,886,006 (GRCm39) N52I possibly damaging Het
Sycn C A 7: 28,240,494 (GRCm39) Q54K probably benign Het
Syngr4 A G 7: 45,536,464 (GRCm39) V186A probably benign Het
Tars3 G A 7: 65,305,539 (GRCm39) M254I possibly damaging Het
Tcaf2 A T 6: 42,619,738 (GRCm39) H96Q probably benign Het
Tcp11l2 T C 10: 84,449,363 (GRCm39) Y443H probably damaging Het
Tmem200c A T 17: 69,149,244 (GRCm39) Q609L possibly damaging Het
Tmx3 G A 18: 90,535,614 (GRCm39) G83R probably damaging Het
Tpgs2 A C 18: 25,301,598 (GRCm39) V23G possibly damaging Het
Trhr T C 15: 44,060,579 (GRCm39) V33A probably benign Het
Trim66 A T 7: 109,074,320 (GRCm39) I647N probably damaging Het
Trnt1 A G 6: 106,755,000 (GRCm39) K244E probably damaging Het
Tsfm G A 10: 126,864,314 (GRCm39) Q134* probably null Het
Ttll9 A G 2: 152,844,927 (GRCm39) T432A probably benign Het
Vmn2r78 C T 7: 86,603,690 (GRCm39) L623F probably damaging Het
Wdr55 A G 18: 36,895,419 (GRCm39) N132S possibly damaging Het
Wipf2 A T 11: 98,787,040 (GRCm39) R356S possibly damaging Het
Wnk1 A G 6: 119,925,949 (GRCm39) probably benign Het
Zfp260 A G 7: 29,804,765 (GRCm39) K222E probably damaging Het
Zfp300 A G X: 20,948,190 (GRCm39) S525P possibly damaging Het
Zfp592 A G 7: 80,687,950 (GRCm39) T959A probably benign Het
Other mutations in Camta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Camta2 APN 11 70,562,308 (GRCm39) nonsense probably null
IGL01472:Camta2 APN 11 70,574,950 (GRCm39) missense probably damaging 1.00
IGL02548:Camta2 APN 11 70,561,511 (GRCm39) missense probably damaging 1.00
IGL02794:Camta2 APN 11 70,566,484 (GRCm39) missense possibly damaging 0.94
IGL02983:Camta2 APN 11 70,562,848 (GRCm39) missense probably damaging 0.99
IGL03035:Camta2 APN 11 70,562,335 (GRCm39) nonsense probably null
weeping UTSW 11 70,574,134 (GRCm39) missense probably damaging 1.00
Willow UTSW 11 70,569,151 (GRCm39) missense probably damaging 1.00
P0027:Camta2 UTSW 11 70,574,831 (GRCm39) missense probably damaging 1.00
R0360:Camta2 UTSW 11 70,574,136 (GRCm39) missense probably damaging 1.00
R0364:Camta2 UTSW 11 70,574,136 (GRCm39) missense probably damaging 1.00
R0541:Camta2 UTSW 11 70,572,447 (GRCm39) missense probably benign 0.01
R0600:Camta2 UTSW 11 70,564,785 (GRCm39) missense possibly damaging 0.94
R0630:Camta2 UTSW 11 70,569,131 (GRCm39) missense probably damaging 1.00
R1301:Camta2 UTSW 11 70,567,230 (GRCm39) missense probably benign 0.18
R1346:Camta2 UTSW 11 70,567,293 (GRCm39) missense possibly damaging 0.89
R1826:Camta2 UTSW 11 70,574,134 (GRCm39) missense probably damaging 1.00
R1881:Camta2 UTSW 11 70,562,842 (GRCm39) missense probably benign 0.00
R1980:Camta2 UTSW 11 70,573,308 (GRCm39) missense probably benign 0.43
R2145:Camta2 UTSW 11 70,562,401 (GRCm39) missense probably benign 0.31
R2763:Camta2 UTSW 11 70,573,356 (GRCm39) nonsense probably null
R2881:Camta2 UTSW 11 70,570,490 (GRCm39) splice site probably null
R2917:Camta2 UTSW 11 70,571,787 (GRCm39) missense probably damaging 1.00
R4115:Camta2 UTSW 11 70,567,300 (GRCm39) missense possibly damaging 0.93
R4321:Camta2 UTSW 11 70,569,151 (GRCm39) missense probably damaging 1.00
R4470:Camta2 UTSW 11 70,571,766 (GRCm39) missense probably damaging 1.00
R4499:Camta2 UTSW 11 70,565,512 (GRCm39) missense probably damaging 1.00
R4509:Camta2 UTSW 11 70,571,844 (GRCm39) missense probably benign 0.28
R6154:Camta2 UTSW 11 70,569,211 (GRCm39) missense probably damaging 1.00
R6166:Camta2 UTSW 11 70,565,087 (GRCm39) splice site probably null
R6287:Camta2 UTSW 11 70,572,295 (GRCm39) missense probably damaging 0.98
R6382:Camta2 UTSW 11 70,562,867 (GRCm39) missense probably damaging 0.99
R6864:Camta2 UTSW 11 70,562,792 (GRCm39) missense probably benign 0.00
R6922:Camta2 UTSW 11 70,564,964 (GRCm39) missense probably benign 0.04
R7438:Camta2 UTSW 11 70,574,714 (GRCm39) critical splice donor site probably null
R7611:Camta2 UTSW 11 70,572,372 (GRCm39) missense possibly damaging 0.85
R7883:Camta2 UTSW 11 70,566,037 (GRCm39) missense probably damaging 1.00
R8094:Camta2 UTSW 11 70,576,903 (GRCm39) missense probably damaging 1.00
R8232:Camta2 UTSW 11 70,573,841 (GRCm39) missense unknown
R8271:Camta2 UTSW 11 70,561,886 (GRCm39) missense probably benign 0.05
R8973:Camta2 UTSW 11 70,561,184 (GRCm39) missense probably benign 0.05
R9072:Camta2 UTSW 11 70,567,234 (GRCm39) missense probably benign 0.21
T0722:Camta2 UTSW 11 70,574,831 (GRCm39) missense probably damaging 1.00
X0066:Camta2 UTSW 11 70,572,504 (GRCm39) missense probably benign 0.08
Z1177:Camta2 UTSW 11 70,566,047 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTAAGGCCTCTGAGTGAGTGC -3'
(R):5'- CTGGTGAACTCTAGAGCCAC -3'

Sequencing Primer
(F):5'- GTGAGTGCTTGTTCCACAAAAGC -3'
(R):5'- GTGAACTCTAGAGCCACTCTTTACAG -3'
Posted On 2014-10-01