Incidental Mutation 'R2144:Rap1gap2'
ID 236656
Institutional Source Beutler Lab
Gene Symbol Rap1gap2
Ensembl Gene ENSMUSG00000038807
Gene Name RAP1 GTPase activating protein 2
Synonyms Garnl4, LOC380710
MMRRC Submission 040147-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2144 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 74274182-74501741 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74316802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 245 (T245M)
Ref Sequence ENSEMBL: ENSMUSP00000040180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047488] [ENSMUST00000102521]
AlphaFold Q5SVL6
Predicted Effect probably damaging
Transcript: ENSMUST00000047488
AA Change: T245M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040180
Gene: ENSMUSG00000038807
AA Change: T245M

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 445 1.2e-64 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102521
AA Change: T185M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099580
Gene: ENSMUSG00000038807
AA Change: T185M

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 439 4.9e-67 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Meta Mutation Damage Score 0.0952 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein that activates the small guanine-nucleotide-binding protein Rap1 in platelets. The protein interacts with synaptotagmin-like protein 1 and Rab27 and regulates secretion of dense granules from platelets at sites of endothelial damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,412 (GRCm39) T69S unknown Het
4930553M12Rik G A 4: 88,786,411 (GRCm39) T69I unknown Het
Acsl6 A T 11: 54,232,604 (GRCm39) Q485L probably damaging Het
Adam5 C A 8: 25,305,496 (GRCm39) V81F probably benign Het
Aoc1l1 A G 6: 48,952,225 (GRCm39) H50R probably benign Het
Bag2 A G 1: 33,785,912 (GRCm39) S137P possibly damaging Het
Birc6 A T 17: 74,967,408 (GRCm39) Q4103L possibly damaging Het
Camta2 A G 11: 70,562,401 (GRCm39) F999L probably benign Het
Cap2 A T 13: 46,713,978 (GRCm39) probably null Het
Ccnk T A 12: 108,155,349 (GRCm39) L102Q probably null Het
Cd52 T C 4: 133,821,048 (GRCm39) probably benign Het
Cdc123 A T 2: 5,815,617 (GRCm39) I160K probably benign Het
Cep85l T C 10: 53,234,222 (GRCm39) N52S probably benign Het
Cntnap5a C T 1: 116,029,440 (GRCm39) T298I probably benign Het
Cpsf4 G T 5: 145,115,572 (GRCm39) S192I probably benign Het
Cpxm1 A G 2: 130,239,330 (GRCm39) S33P probably benign Het
Cyp2a12 A T 7: 26,734,194 (GRCm39) T376S possibly damaging Het
Cyp3a16 A G 5: 145,392,894 (GRCm39) F137S probably damaging Het
Des A G 1: 75,343,448 (GRCm39) T444A probably benign Het
Dgcr8 C T 16: 18,102,120 (GRCm39) G54D probably damaging Het
Dmac2l A G 12: 69,787,828 (GRCm39) Q88R probably damaging Het
Dsc3 A G 18: 20,113,743 (GRCm39) F393S possibly damaging Het
Dstyk T A 1: 132,391,113 (GRCm39) M838K probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Eml5 A C 12: 98,776,864 (GRCm39) F1417C probably damaging Het
Ep400 A T 5: 110,851,384 (GRCm39) M1366K unknown Het
Epg5 G T 18: 77,997,412 (GRCm39) C425F possibly damaging Het
Epha3 C G 16: 63,593,680 (GRCm39) R136P possibly damaging Het
Extl1 C A 4: 134,098,355 (GRCm39) E225D probably benign Het
Fam186b A G 15: 99,178,538 (GRCm39) Y263H probably benign Het
Fbn2 A G 18: 58,186,065 (GRCm39) V1761A possibly damaging Het
Fer1l6 T A 15: 58,499,383 (GRCm39) M1251K probably benign Het
Gart A T 16: 91,426,969 (GRCm39) I555N probably damaging Het
Gm11596 A T 11: 99,683,789 (GRCm39) C110* probably null Het
Gnptab C T 10: 88,264,368 (GRCm39) S262L possibly damaging Het
Gpr21 T C 2: 37,408,243 (GRCm39) V263A probably benign Het
Gxylt1 T C 15: 93,152,361 (GRCm39) I224V probably benign Het
H2-Aa A G 17: 34,502,801 (GRCm39) S122P probably damaging Het
Hsph1 A C 5: 149,553,802 (GRCm39) probably null Het
Hunk G A 16: 90,229,420 (GRCm39) D94N probably damaging Het
Ikbke C A 1: 131,201,211 (GRCm39) V176L probably damaging Het
Inpp5k A T 11: 75,538,017 (GRCm39) probably null Het
Ints10 A G 8: 69,249,457 (GRCm39) T96A probably damaging Het
Kansl2 A T 15: 98,424,512 (GRCm39) V306E probably benign Het
Kif20a A G 18: 34,758,657 (GRCm39) D42G possibly damaging Het
Klhl7 A T 5: 24,305,861 (GRCm39) M37L probably benign Het
Krtap1-5 T C 11: 99,471,644 (GRCm39) I50V probably benign Het
Ktn1 A G 14: 47,952,109 (GRCm39) E983G probably damaging Het
Lrrk1 G A 7: 65,945,911 (GRCm39) S566L probably damaging Het
M6pr A G 6: 122,292,326 (GRCm39) M174V probably benign Het
Man2a2 A G 7: 80,013,264 (GRCm39) S510P probably damaging Het
Mmrn1 G A 6: 60,922,059 (GRCm39) S172N possibly damaging Het
Mpv17 A G 5: 31,311,533 (GRCm39) probably null Het
Mrgpra9 T C 7: 46,885,211 (GRCm39) E152G probably benign Het
Mst1r T C 9: 107,790,367 (GRCm39) V660A probably benign Het
Myof A G 19: 37,969,669 (GRCm39) probably null Het
Myrf G A 19: 10,206,038 (GRCm39) P126L probably benign Het
Nckap1l C T 15: 103,384,103 (GRCm39) A567V probably damaging Het
Nphs1 A G 7: 30,160,395 (GRCm39) E169G probably benign Het
Npy1r T A 8: 67,157,836 (GRCm39) V382D probably benign Het
Nrl A T 14: 55,758,307 (GRCm39) M140K possibly damaging Het
Odad2 C T 18: 7,127,229 (GRCm39) E995K probably damaging Het
Or14c39 T A 7: 86,344,488 (GRCm39) F275I probably damaging Het
Or2ag1b A T 7: 106,288,164 (GRCm39) M258K probably damaging Het
Or4f56 A G 2: 111,703,768 (GRCm39) I144T probably damaging Het
Or5ac17 C T 16: 59,036,389 (GRCm39) V196M probably benign Het
Or8d2 C T 9: 38,759,635 (GRCm39) T75I probably damaging Het
Orc5 T A 5: 22,752,925 (GRCm39) L36F possibly damaging Het
Osbpl1a A T 18: 13,004,230 (GRCm39) S396T probably benign Het
Pappa T A 4: 65,099,186 (GRCm39) Y568* probably null Het
Pask C T 1: 93,249,019 (GRCm39) A794T probably benign Het
Pclo C T 5: 14,908,766 (GRCm39) L5025F unknown Het
Pde3a T C 6: 141,435,837 (GRCm39) V924A probably benign Het
Pdpr A G 8: 111,844,668 (GRCm39) N355S probably damaging Het
Pepd A T 7: 34,620,843 (GRCm39) K36M probably benign Het
Pet100 T G 8: 3,672,355 (GRCm39) L14R probably damaging Het
Pfkfb2 T C 1: 130,626,460 (GRCm39) T438A probably benign Het
Pik3r6 T A 11: 68,434,437 (GRCm39) L546* probably null Het
Pira2 A T 7: 3,847,344 (GRCm39) L115Q probably damaging Het
Plxdc1 T C 11: 97,824,838 (GRCm39) Y339C probably damaging Het
Primpol A T 8: 47,039,378 (GRCm39) M414K probably damaging Het
Prol1 A T 5: 88,476,254 (GRCm39) T215S unknown Het
Prss22 A G 17: 24,213,656 (GRCm39) Y212H probably damaging Het
Ralgapa2 C A 2: 146,230,524 (GRCm39) V1014L probably damaging Het
Rbm26 T A 14: 105,352,638 (GRCm39) R1009* probably null Het
Rbm42 A G 7: 30,340,535 (GRCm39) *450Q probably null Het
Rere T C 4: 150,701,388 (GRCm39) V1256A probably damaging Het
Rmi1 G T 13: 58,555,797 (GRCm39) L15F probably damaging Het
Rnf213 T C 11: 119,334,516 (GRCm39) S3242P probably damaging Het
Rtel1 T A 2: 180,965,499 (GRCm39) V167E probably damaging Het
Scgb1b2 G T 7: 30,991,188 (GRCm39) probably benign Het
Sin3b T C 8: 73,457,893 (GRCm39) L203P probably damaging Het
Skint6 T C 4: 113,093,457 (GRCm39) S229G possibly damaging Het
Slco1a4 T C 6: 141,755,104 (GRCm39) Y566C probably damaging Het
Smgc T G 15: 91,728,624 (GRCm39) D121E possibly damaging Het
Sned1 T A 1: 93,199,406 (GRCm39) F495L probably damaging Het
St7 A T 6: 17,886,006 (GRCm39) N52I possibly damaging Het
Sycn C A 7: 28,240,494 (GRCm39) Q54K probably benign Het
Syngr4 A G 7: 45,536,464 (GRCm39) V186A probably benign Het
Tars3 G A 7: 65,305,539 (GRCm39) M254I possibly damaging Het
Tcaf2 A T 6: 42,619,738 (GRCm39) H96Q probably benign Het
Tcp11l2 T C 10: 84,449,363 (GRCm39) Y443H probably damaging Het
Tmem200c A T 17: 69,149,244 (GRCm39) Q609L possibly damaging Het
Tmx3 G A 18: 90,535,614 (GRCm39) G83R probably damaging Het
Tpgs2 A C 18: 25,301,598 (GRCm39) V23G possibly damaging Het
Trhr T C 15: 44,060,579 (GRCm39) V33A probably benign Het
Trim66 A T 7: 109,074,320 (GRCm39) I647N probably damaging Het
Trnt1 A G 6: 106,755,000 (GRCm39) K244E probably damaging Het
Tsfm G A 10: 126,864,314 (GRCm39) Q134* probably null Het
Ttll9 A G 2: 152,844,927 (GRCm39) T432A probably benign Het
Vmn2r78 C T 7: 86,603,690 (GRCm39) L623F probably damaging Het
Wdr55 A G 18: 36,895,419 (GRCm39) N132S possibly damaging Het
Wipf2 A T 11: 98,787,040 (GRCm39) R356S possibly damaging Het
Wnk1 A G 6: 119,925,949 (GRCm39) probably benign Het
Zfp260 A G 7: 29,804,765 (GRCm39) K222E probably damaging Het
Zfp300 A G X: 20,948,190 (GRCm39) S525P possibly damaging Het
Zfp592 A G 7: 80,687,950 (GRCm39) T959A probably benign Het
Other mutations in Rap1gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Rap1gap2 APN 11 74,307,085 (GRCm39) missense probably benign 0.25
IGL00839:Rap1gap2 APN 11 74,328,274 (GRCm39) missense probably damaging 1.00
IGL02301:Rap1gap2 APN 11 74,298,195 (GRCm39) missense probably damaging 1.00
IGL02367:Rap1gap2 APN 11 74,288,181 (GRCm39) critical splice donor site probably null
IGL02832:Rap1gap2 APN 11 74,303,281 (GRCm39) splice site probably benign
IGL03067:Rap1gap2 APN 11 74,284,238 (GRCm39) missense possibly damaging 0.63
IGL03341:Rap1gap2 APN 11 74,326,540 (GRCm39) missense probably damaging 1.00
IGL03355:Rap1gap2 APN 11 74,303,170 (GRCm39) missense probably damaging 1.00
drummerboy UTSW 11 74,298,198 (GRCm39) missense probably damaging 1.00
magister UTSW 11 74,326,587 (GRCm39) nonsense probably null
P0026:Rap1gap2 UTSW 11 74,458,036 (GRCm39) splice site probably benign
R0106:Rap1gap2 UTSW 11 74,326,570 (GRCm39) missense probably benign 0.10
R0106:Rap1gap2 UTSW 11 74,326,570 (GRCm39) missense probably benign 0.10
R0514:Rap1gap2 UTSW 11 74,279,680 (GRCm39) missense possibly damaging 0.74
R0518:Rap1gap2 UTSW 11 74,332,592 (GRCm39) missense probably damaging 1.00
R0521:Rap1gap2 UTSW 11 74,332,592 (GRCm39) missense probably damaging 1.00
R1070:Rap1gap2 UTSW 11 74,327,853 (GRCm39) missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74,327,853 (GRCm39) missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74,327,853 (GRCm39) missense possibly damaging 0.71
R1998:Rap1gap2 UTSW 11 74,286,659 (GRCm39) missense probably benign 0.04
R2145:Rap1gap2 UTSW 11 74,316,802 (GRCm39) missense probably damaging 1.00
R2180:Rap1gap2 UTSW 11 74,283,972 (GRCm39) missense probably benign 0.24
R2938:Rap1gap2 UTSW 11 74,298,148 (GRCm39) missense possibly damaging 0.71
R2991:Rap1gap2 UTSW 11 74,298,148 (GRCm39) missense possibly damaging 0.71
R2992:Rap1gap2 UTSW 11 74,298,148 (GRCm39) missense possibly damaging 0.71
R2993:Rap1gap2 UTSW 11 74,298,148 (GRCm39) missense possibly damaging 0.71
R3033:Rap1gap2 UTSW 11 74,298,148 (GRCm39) missense possibly damaging 0.71
R3035:Rap1gap2 UTSW 11 74,298,148 (GRCm39) missense possibly damaging 0.71
R3686:Rap1gap2 UTSW 11 74,298,148 (GRCm39) missense possibly damaging 0.71
R4426:Rap1gap2 UTSW 11 74,298,148 (GRCm39) missense possibly damaging 0.71
R4427:Rap1gap2 UTSW 11 74,298,148 (GRCm39) missense possibly damaging 0.71
R4621:Rap1gap2 UTSW 11 74,326,525 (GRCm39) critical splice donor site probably null
R4705:Rap1gap2 UTSW 11 74,328,265 (GRCm39) missense probably damaging 1.00
R4809:Rap1gap2 UTSW 11 74,298,800 (GRCm39) splice site probably benign
R5092:Rap1gap2 UTSW 11 74,329,121 (GRCm39) missense probably damaging 1.00
R5283:Rap1gap2 UTSW 11 74,286,651 (GRCm39) missense probably damaging 1.00
R5343:Rap1gap2 UTSW 11 74,332,611 (GRCm39) missense probably damaging 0.99
R5941:Rap1gap2 UTSW 11 74,283,063 (GRCm39) missense probably damaging 1.00
R6414:Rap1gap2 UTSW 11 74,296,616 (GRCm39) missense probably damaging 1.00
R6647:Rap1gap2 UTSW 11 74,298,754 (GRCm39) missense probably benign 0.04
R6951:Rap1gap2 UTSW 11 74,375,774 (GRCm39) missense possibly damaging 0.81
R7096:Rap1gap2 UTSW 11 74,283,057 (GRCm39) missense probably damaging 0.99
R7107:Rap1gap2 UTSW 11 74,283,945 (GRCm39) missense probably damaging 1.00
R7397:Rap1gap2 UTSW 11 74,305,237 (GRCm39) missense probably benign 0.28
R7553:Rap1gap2 UTSW 11 74,326,548 (GRCm39) missense probably damaging 0.97
R8038:Rap1gap2 UTSW 11 74,283,109 (GRCm39) missense probably benign 0.00
R8051:Rap1gap2 UTSW 11 74,286,651 (GRCm39) missense probably damaging 0.97
R8466:Rap1gap2 UTSW 11 74,316,057 (GRCm39) missense probably benign 0.33
R8772:Rap1gap2 UTSW 11 74,296,551 (GRCm39) missense probably damaging 1.00
R8853:Rap1gap2 UTSW 11 74,298,198 (GRCm39) missense probably damaging 1.00
R8914:Rap1gap2 UTSW 11 74,326,587 (GRCm39) nonsense probably null
R9506:Rap1gap2 UTSW 11 74,305,266 (GRCm39) missense probably damaging 0.98
R9600:Rap1gap2 UTSW 11 74,283,954 (GRCm39) missense probably benign 0.01
Z1176:Rap1gap2 UTSW 11 74,501,703 (GRCm39) frame shift probably null
Z1186:Rap1gap2 UTSW 11 74,487,721 (GRCm39) missense probably benign 0.41
Z1187:Rap1gap2 UTSW 11 74,487,721 (GRCm39) missense probably benign 0.41
Z1188:Rap1gap2 UTSW 11 74,487,721 (GRCm39) missense probably benign 0.41
Z1189:Rap1gap2 UTSW 11 74,487,721 (GRCm39) missense probably benign 0.41
Z1190:Rap1gap2 UTSW 11 74,487,721 (GRCm39) missense probably benign 0.41
Z1191:Rap1gap2 UTSW 11 74,487,721 (GRCm39) missense probably benign 0.41
Z1192:Rap1gap2 UTSW 11 74,487,721 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CTGCTAAGAGCCATCTCACC -3'
(R):5'- CTGGTGCACACAGTAAGGAG -3'

Sequencing Primer
(F):5'- GAGCCATCTCACCCCATCTAGG -3'
(R):5'- GCACACAGTAAGGAGTTCATTTTCTC -3'
Posted On 2014-10-01