Mutagenetix > Incidental Mutation

Incidental Mutation 'R2144:Eml5'

236665

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

040147-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R2144 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 98810605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Cysteine at position 1417 (F1417C)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably damaging
Transcript: ENSMUST00000065716
AA Change: F1370C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: F1370C

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222872

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: F1417C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	G	A	4: 88,868,174	T69I	unknown	Het
4930553M12Rik	T	A	4: 88,868,175	T69S	unknown	Het
Acsl6	A	T	11: 54,341,778	Q485L	probably damaging	Het
Adam5	C	A	8: 24,815,480	V81F	probably benign	Het
Armc4	C	T	18: 7,127,229	E995K	probably damaging	Het
Atp5s	A	G	12: 69,741,054	Q88R	probably damaging	Het
Bag2	A	G	1: 33,746,831	S137P	possibly damaging	Het
Birc6	A	T	17: 74,660,413	Q4103L	possibly damaging	Het
Camta2	A	G	11: 70,671,575	F999L	probably benign	Het
Cap2	A	T	13: 46,560,502		probably null	Het
Ccnk	T	A	12: 108,189,090	L102Q	probably null	Het
Cd52	T	C	4: 134,093,737		probably benign	Het
Cdc123	A	T	2: 5,810,806	I160K	probably benign	Het
Cep85l	T	C	10: 53,358,126	N52S	probably benign	Het
Cntnap5a	C	T	1: 116,101,710	T298I	probably benign	Het
Cpsf4	G	T	5: 145,178,762	S192I	probably benign	Het
Cpxm1	A	G	2: 130,397,410	S33P	probably benign	Het
Cyp2a12	A	T	7: 27,034,769	T376S	possibly damaging	Het
Cyp3a16	A	G	5: 145,456,084	F137S	probably damaging	Het
Des	A	G	1: 75,366,804	T444A	probably benign	Het
Dgcr8	C	T	16: 18,284,256	G54D	probably damaging	Het
Doxl2	A	G	6: 48,975,291	H50R	probably benign	Het
Dsc3	A	G	18: 19,980,686	F393S	possibly damaging	Het
Dstyk	T	A	1: 132,463,375	M838K	probably damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Ep400	A	T	5: 110,703,518	M1366K	unknown	Het
Epg5	G	T	18: 77,954,197	C425F	possibly damaging	Het
Epha3	C	G	16: 63,773,317	R136P	possibly damaging	Het
Extl1	C	A	4: 134,371,044	E225D	probably benign	Het
Fam186b	A	G	15: 99,280,657	Y263H	probably benign	Het
Fbn2	A	G	18: 58,052,993	V1761A	possibly damaging	Het
Fer1l6	T	A	15: 58,627,534	M1251K	probably benign	Het
Gart	A	T	16: 91,630,081	I555N	probably damaging	Het
Gm11596	A	T	11: 99,792,963	C110*	probably null	Het
Gnptab	C	T	10: 88,428,506	S262L	possibly damaging	Het
Gpr21	T	C	2: 37,518,231	V263A	probably benign	Het
Gxylt1	T	C	15: 93,254,480	I224V	probably benign	Het
H2-Aa	A	G	17: 34,283,827	S122P	probably damaging	Het
Hsph1	A	C	5: 149,630,337		probably null	Het
Hunk	G	A	16: 90,432,532	D94N	probably damaging	Het
Ikbke	C	A	1: 131,273,474	V176L	probably damaging	Het
Inpp5k	A	T	11: 75,647,191		probably null	Het
Ints10	A	G	8: 68,796,805	T96A	probably damaging	Het
Kansl2	A	T	15: 98,526,631	V306E	probably benign	Het
Kif20a	A	G	18: 34,625,604	D42G	possibly damaging	Het
Klhl7	A	T	5: 24,100,863	M37L	probably benign	Het
Krtap1-5	T	C	11: 99,580,818	I50V	probably benign	Het
Ktn1	A	G	14: 47,714,652	E983G	probably damaging	Het
Lrrk1	G	A	7: 66,296,163	S566L	probably damaging	Het
M6pr	A	G	6: 122,315,367	M174V	probably benign	Het
Man2a2	A	G	7: 80,363,516	S510P	probably damaging	Het
Mmrn1	G	A	6: 60,945,075	S172N	possibly damaging	Het
Mpv17	A	G	5: 31,154,189		probably null	Het
Mrgpra9	T	C	7: 47,235,463	E152G	probably benign	Het
Mst1r	T	C	9: 107,913,168	V660A	probably benign	Het
Myof	A	G	19: 37,981,221		probably null	Het
Myrf	G	A	19: 10,228,674	P126L	probably benign	Het
Nckap1l	C	T	15: 103,475,676	A567V	probably damaging	Het
Nphs1	A	G	7: 30,460,970	E169G	probably benign	Het
Npy1r	T	A	8: 66,705,184	V382D	probably benign	Het
Nrl	A	T	14: 55,520,850	M140K	possibly damaging	Het
Olfr1305	A	G	2: 111,873,423	I144T	probably damaging	Het
Olfr199	C	T	16: 59,216,026	V196M	probably benign	Het
Olfr292	T	A	7: 86,695,280	F275I	probably damaging	Het
Olfr694	A	T	7: 106,688,957	M258K	probably damaging	Het
Olfr924	C	T	9: 38,848,339	T75I	probably damaging	Het
Orc5	T	A	5: 22,547,927	L36F	possibly damaging	Het
Osbpl1a	A	T	18: 12,871,173	S396T	probably benign	Het
Pappa	T	A	4: 65,180,949	Y568*	probably null	Het
Pask	C	T	1: 93,321,297	A794T	probably benign	Het
Pclo	C	T	5: 14,858,752	L5025F	unknown	Het
Pde3a	T	C	6: 141,490,111	V924A	probably benign	Het
Pdpr	A	G	8: 111,118,036	N355S	probably damaging	Het
Pepd	A	T	7: 34,921,418	K36M	probably benign	Het
Pet100	T	G	8: 3,622,355	L14R	probably damaging	Het
Pfkfb2	T	C	1: 130,698,723	T438A	probably benign	Het
Pik3r6	T	A	11: 68,543,611	L546*	probably null	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Plxdc1	T	C	11: 97,934,012	Y339C	probably damaging	Het
Primpol	A	T	8: 46,586,343	M414K	probably damaging	Het
Prol1	A	T	5: 88,328,395	T215S	unknown	Het
Prss22	A	G	17: 23,994,682	Y212H	probably damaging	Het
Ralgapa2	C	A	2: 146,388,604	V1014L	probably damaging	Het
Rap1gap2	G	A	11: 74,425,976	T245M	probably damaging	Het
Rbm26	T	A	14: 105,115,202	R1009*	probably null	Het
Rbm42	A	G	7: 30,641,110	*450Q	probably null	Het
Rere	T	C	4: 150,616,931	V1256A	probably damaging	Het
Rmi1	G	T	13: 58,407,983	L15F	probably damaging	Het
Rnf213	T	C	11: 119,443,690	S3242P	probably damaging	Het
Rtel1	T	A	2: 181,323,706	V167E	probably damaging	Het
Scgb1b2	G	T	7: 31,291,763		probably benign	Het
Sin3b	T	C	8: 72,731,265	L203P	probably damaging	Het
Skint6	T	C	4: 113,236,260	S229G	possibly damaging	Het
Slco1a4	T	C	6: 141,809,378	Y566C	probably damaging	Het
Smgc	T	G	15: 91,844,421	D121E	possibly damaging	Het
Sned1	T	A	1: 93,271,684	F495L	probably damaging	Het
St7	A	T	6: 17,886,007	N52I	possibly damaging	Het
Sycn	C	A	7: 28,541,069	Q54K	probably benign	Het
Syngr4	A	G	7: 45,887,040	V186A	probably benign	Het
Tarsl2	G	A	7: 65,655,791	M254I	possibly damaging	Het
Tcaf2	A	T	6: 42,642,804	H96Q	probably benign	Het
Tcp11l2	T	C	10: 84,613,499	Y443H	probably damaging	Het
Tmem200c	A	T	17: 68,842,249	Q609L	possibly damaging	Het
Tmx3	G	A	18: 90,517,490	G83R	probably damaging	Het
Tpgs2	A	C	18: 25,168,541	V23G	possibly damaging	Het
Trhr	T	C	15: 44,197,183	V33A	probably benign	Het
Trim66	A	T	7: 109,475,113	I647N	probably damaging	Het
Trnt1	A	G	6: 106,778,039	K244E	probably damaging	Het
Tsfm	G	A	10: 127,028,445	Q134*	probably null	Het
Ttll9	A	G	2: 153,003,007	T432A	probably benign	Het
Vmn2r78	C	T	7: 86,954,482	L623F	probably damaging	Het
Wdr55	A	G	18: 36,762,366	N132S	possibly damaging	Het
Wipf2	A	T	11: 98,896,214	R356S	possibly damaging	Het
Wnk1	A	G	6: 119,948,988		probably benign	Het
Zfp260	A	G	7: 30,105,340	K222E	probably damaging	Het
Zfp300	A	G	X: 21,081,951	S525P	possibly damaging	Het
Zfp592	A	G	7: 81,038,202	T959A	probably benign	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGTAATCGGGCTAGGTTCTG -3'
(R):5'- AGATTACTGATTCATTGCCGTCC -3'

Sequencing Primer
(F):5'- GCTAGGTTCTGTATGCACACATG -3'
(R):5'- CTTTTGATAGTAGTCACTTGCATGC -3'

Posted On

2014-10-01