Incidental Mutation 'R2144:Nrl'
ID 236671
Institutional Source Beutler Lab
Gene Symbol Nrl
Ensembl Gene ENSMUSG00000040632
Gene Name neural retina leucine zipper gene
Synonyms
MMRRC Submission 040147-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.731) question?
Stock # R2144 (G1)
Quality Score 84
Status Not validated
Chromosome 14
Chromosomal Location 55756972-55762438 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55758307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 140 (M140K)
Ref Sequence ENSEMBL: ENSMUSP00000153933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062232] [ENSMUST00000074225] [ENSMUST00000111404] [ENSMUST00000163767] [ENSMUST00000165262] [ENSMUST00000178694] [ENSMUST00000228287] [ENSMUST00000228902] [ENSMUST00000171643]
AlphaFold P54846
Predicted Effect probably benign
Transcript: ENSMUST00000062232
AA Change: M140K

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054457
Gene: ENSMUSG00000040632
AA Change: M140K

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 101 7.3e-18 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074225
SMART Domains Protein: ENSMUSP00000073847
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111404
AA Change: M140K

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107035
Gene: ENSMUSG00000040632
AA Change: M140K

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163767
SMART Domains Protein: ENSMUSP00000126493
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165262
SMART Domains Protein: ENSMUSP00000132999
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 505 2.34e-14 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169869
Predicted Effect probably benign
Transcript: ENSMUST00000178694
AA Change: M140K

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136445
Gene: ENSMUSG00000040632
AA Change: M140K

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170155
Predicted Effect possibly damaging
Transcript: ENSMUST00000228287
AA Change: M140K

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226858
Predicted Effect probably benign
Transcript: ENSMUST00000228902
Predicted Effect probably benign
Transcript: ENSMUST00000171643
SMART Domains Protein: ENSMUSP00000128555
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228351
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the basic leucine zipper domain family of transcription factors. The encoded protein is preferentially expressed in the retina and is necessary for rod photoreceptor development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a retinal defect causing loss of rod function, exaggerated cone function, short, sparse outer segments, and abnormal disks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,412 (GRCm39) T69S unknown Het
4930553M12Rik G A 4: 88,786,411 (GRCm39) T69I unknown Het
Acsl6 A T 11: 54,232,604 (GRCm39) Q485L probably damaging Het
Adam5 C A 8: 25,305,496 (GRCm39) V81F probably benign Het
Aoc1l1 A G 6: 48,952,225 (GRCm39) H50R probably benign Het
Bag2 A G 1: 33,785,912 (GRCm39) S137P possibly damaging Het
Birc6 A T 17: 74,967,408 (GRCm39) Q4103L possibly damaging Het
Camta2 A G 11: 70,562,401 (GRCm39) F999L probably benign Het
Cap2 A T 13: 46,713,978 (GRCm39) probably null Het
Ccnk T A 12: 108,155,349 (GRCm39) L102Q probably null Het
Cd52 T C 4: 133,821,048 (GRCm39) probably benign Het
Cdc123 A T 2: 5,815,617 (GRCm39) I160K probably benign Het
Cep85l T C 10: 53,234,222 (GRCm39) N52S probably benign Het
Cntnap5a C T 1: 116,029,440 (GRCm39) T298I probably benign Het
Cpsf4 G T 5: 145,115,572 (GRCm39) S192I probably benign Het
Cpxm1 A G 2: 130,239,330 (GRCm39) S33P probably benign Het
Cyp2a12 A T 7: 26,734,194 (GRCm39) T376S possibly damaging Het
Cyp3a16 A G 5: 145,392,894 (GRCm39) F137S probably damaging Het
Des A G 1: 75,343,448 (GRCm39) T444A probably benign Het
Dgcr8 C T 16: 18,102,120 (GRCm39) G54D probably damaging Het
Dmac2l A G 12: 69,787,828 (GRCm39) Q88R probably damaging Het
Dsc3 A G 18: 20,113,743 (GRCm39) F393S possibly damaging Het
Dstyk T A 1: 132,391,113 (GRCm39) M838K probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Eml5 A C 12: 98,776,864 (GRCm39) F1417C probably damaging Het
Ep400 A T 5: 110,851,384 (GRCm39) M1366K unknown Het
Epg5 G T 18: 77,997,412 (GRCm39) C425F possibly damaging Het
Epha3 C G 16: 63,593,680 (GRCm39) R136P possibly damaging Het
Extl1 C A 4: 134,098,355 (GRCm39) E225D probably benign Het
Fam186b A G 15: 99,178,538 (GRCm39) Y263H probably benign Het
Fbn2 A G 18: 58,186,065 (GRCm39) V1761A possibly damaging Het
Fer1l6 T A 15: 58,499,383 (GRCm39) M1251K probably benign Het
Gart A T 16: 91,426,969 (GRCm39) I555N probably damaging Het
Gm11596 A T 11: 99,683,789 (GRCm39) C110* probably null Het
Gnptab C T 10: 88,264,368 (GRCm39) S262L possibly damaging Het
Gpr21 T C 2: 37,408,243 (GRCm39) V263A probably benign Het
Gxylt1 T C 15: 93,152,361 (GRCm39) I224V probably benign Het
H2-Aa A G 17: 34,502,801 (GRCm39) S122P probably damaging Het
Hsph1 A C 5: 149,553,802 (GRCm39) probably null Het
Hunk G A 16: 90,229,420 (GRCm39) D94N probably damaging Het
Ikbke C A 1: 131,201,211 (GRCm39) V176L probably damaging Het
Inpp5k A T 11: 75,538,017 (GRCm39) probably null Het
Ints10 A G 8: 69,249,457 (GRCm39) T96A probably damaging Het
Kansl2 A T 15: 98,424,512 (GRCm39) V306E probably benign Het
Kif20a A G 18: 34,758,657 (GRCm39) D42G possibly damaging Het
Klhl7 A T 5: 24,305,861 (GRCm39) M37L probably benign Het
Krtap1-5 T C 11: 99,471,644 (GRCm39) I50V probably benign Het
Ktn1 A G 14: 47,952,109 (GRCm39) E983G probably damaging Het
Lrrk1 G A 7: 65,945,911 (GRCm39) S566L probably damaging Het
M6pr A G 6: 122,292,326 (GRCm39) M174V probably benign Het
Man2a2 A G 7: 80,013,264 (GRCm39) S510P probably damaging Het
Mmrn1 G A 6: 60,922,059 (GRCm39) S172N possibly damaging Het
Mpv17 A G 5: 31,311,533 (GRCm39) probably null Het
Mrgpra9 T C 7: 46,885,211 (GRCm39) E152G probably benign Het
Mst1r T C 9: 107,790,367 (GRCm39) V660A probably benign Het
Myof A G 19: 37,969,669 (GRCm39) probably null Het
Myrf G A 19: 10,206,038 (GRCm39) P126L probably benign Het
Nckap1l C T 15: 103,384,103 (GRCm39) A567V probably damaging Het
Nphs1 A G 7: 30,160,395 (GRCm39) E169G probably benign Het
Npy1r T A 8: 67,157,836 (GRCm39) V382D probably benign Het
Odad2 C T 18: 7,127,229 (GRCm39) E995K probably damaging Het
Or14c39 T A 7: 86,344,488 (GRCm39) F275I probably damaging Het
Or2ag1b A T 7: 106,288,164 (GRCm39) M258K probably damaging Het
Or4f56 A G 2: 111,703,768 (GRCm39) I144T probably damaging Het
Or5ac17 C T 16: 59,036,389 (GRCm39) V196M probably benign Het
Or8d2 C T 9: 38,759,635 (GRCm39) T75I probably damaging Het
Orc5 T A 5: 22,752,925 (GRCm39) L36F possibly damaging Het
Osbpl1a A T 18: 13,004,230 (GRCm39) S396T probably benign Het
Pappa T A 4: 65,099,186 (GRCm39) Y568* probably null Het
Pask C T 1: 93,249,019 (GRCm39) A794T probably benign Het
Pclo C T 5: 14,908,766 (GRCm39) L5025F unknown Het
Pde3a T C 6: 141,435,837 (GRCm39) V924A probably benign Het
Pdpr A G 8: 111,844,668 (GRCm39) N355S probably damaging Het
Pepd A T 7: 34,620,843 (GRCm39) K36M probably benign Het
Pet100 T G 8: 3,672,355 (GRCm39) L14R probably damaging Het
Pfkfb2 T C 1: 130,626,460 (GRCm39) T438A probably benign Het
Pik3r6 T A 11: 68,434,437 (GRCm39) L546* probably null Het
Pira2 A T 7: 3,847,344 (GRCm39) L115Q probably damaging Het
Plxdc1 T C 11: 97,824,838 (GRCm39) Y339C probably damaging Het
Primpol A T 8: 47,039,378 (GRCm39) M414K probably damaging Het
Prol1 A T 5: 88,476,254 (GRCm39) T215S unknown Het
Prss22 A G 17: 24,213,656 (GRCm39) Y212H probably damaging Het
Ralgapa2 C A 2: 146,230,524 (GRCm39) V1014L probably damaging Het
Rap1gap2 G A 11: 74,316,802 (GRCm39) T245M probably damaging Het
Rbm26 T A 14: 105,352,638 (GRCm39) R1009* probably null Het
Rbm42 A G 7: 30,340,535 (GRCm39) *450Q probably null Het
Rere T C 4: 150,701,388 (GRCm39) V1256A probably damaging Het
Rmi1 G T 13: 58,555,797 (GRCm39) L15F probably damaging Het
Rnf213 T C 11: 119,334,516 (GRCm39) S3242P probably damaging Het
Rtel1 T A 2: 180,965,499 (GRCm39) V167E probably damaging Het
Scgb1b2 G T 7: 30,991,188 (GRCm39) probably benign Het
Sin3b T C 8: 73,457,893 (GRCm39) L203P probably damaging Het
Skint6 T C 4: 113,093,457 (GRCm39) S229G possibly damaging Het
Slco1a4 T C 6: 141,755,104 (GRCm39) Y566C probably damaging Het
Smgc T G 15: 91,728,624 (GRCm39) D121E possibly damaging Het
Sned1 T A 1: 93,199,406 (GRCm39) F495L probably damaging Het
St7 A T 6: 17,886,006 (GRCm39) N52I possibly damaging Het
Sycn C A 7: 28,240,494 (GRCm39) Q54K probably benign Het
Syngr4 A G 7: 45,536,464 (GRCm39) V186A probably benign Het
Tars3 G A 7: 65,305,539 (GRCm39) M254I possibly damaging Het
Tcaf2 A T 6: 42,619,738 (GRCm39) H96Q probably benign Het
Tcp11l2 T C 10: 84,449,363 (GRCm39) Y443H probably damaging Het
Tmem200c A T 17: 69,149,244 (GRCm39) Q609L possibly damaging Het
Tmx3 G A 18: 90,535,614 (GRCm39) G83R probably damaging Het
Tpgs2 A C 18: 25,301,598 (GRCm39) V23G possibly damaging Het
Trhr T C 15: 44,060,579 (GRCm39) V33A probably benign Het
Trim66 A T 7: 109,074,320 (GRCm39) I647N probably damaging Het
Trnt1 A G 6: 106,755,000 (GRCm39) K244E probably damaging Het
Tsfm G A 10: 126,864,314 (GRCm39) Q134* probably null Het
Ttll9 A G 2: 152,844,927 (GRCm39) T432A probably benign Het
Vmn2r78 C T 7: 86,603,690 (GRCm39) L623F probably damaging Het
Wdr55 A G 18: 36,895,419 (GRCm39) N132S possibly damaging Het
Wipf2 A T 11: 98,787,040 (GRCm39) R356S possibly damaging Het
Wnk1 A G 6: 119,925,949 (GRCm39) probably benign Het
Zfp260 A G 7: 29,804,765 (GRCm39) K222E probably damaging Het
Zfp300 A G X: 20,948,190 (GRCm39) S525P possibly damaging Het
Zfp592 A G 7: 80,687,950 (GRCm39) T959A probably benign Het
Other mutations in Nrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Nrl APN 14 55,759,567 (GRCm39) missense probably benign 0.00
R1940:Nrl UTSW 14 55,759,892 (GRCm39) missense probably damaging 1.00
R2311:Nrl UTSW 14 55,759,909 (GRCm39) missense probably damaging 1.00
R4424:Nrl UTSW 14 55,759,675 (GRCm39) missense probably benign 0.04
R5706:Nrl UTSW 14 55,759,889 (GRCm39) missense probably damaging 1.00
R7859:Nrl UTSW 14 55,759,582 (GRCm39) missense probably benign 0.01
R8328:Nrl UTSW 14 55,758,163 (GRCm39) missense probably damaging 0.99
R8871:Nrl UTSW 14 55,758,184 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGCGGGCCTTATAGAG -3'
(R):5'- CATGGTCCAGGTGTGATAGAATC -3'

Sequencing Primer
(F):5'- TTATAGAGGTCGCGCTCGC -3'
(R):5'- CCAGGTGTGATAGAATCTGGGG -3'
Posted On 2014-10-01