Mutagenetix > Incidental Mutations

Incidental Mutation 'R2144:Epha3'

236683

Institutional Source

Beutler Lab

Gene Symbol

Epha3

Ensembl Gene

ENSMUSG00000052504

Gene Name

Eph receptor A3

Synonyms

Tyro4, End3, Cek4, Hek, Hek4, Mek4

MMRRC Submission

040147-MU

Accession Numbers

Genbank: NM_010140; MGI: 99612

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R2144 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63543534-63864175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 63773317 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Proline at position 136 (R136P)

Ref Sequence

ENSEMBL: ENSMUSP00000155997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064405] [ENSMUST00000231270] [ENSMUST00000232049] [ENSMUST00000232461] [ENSMUST00000232654]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064405
AA Change: R136P

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000066554
Gene: ENSMUSG00000052504
AA Change: R136P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EPH_lbd	29	202	1.76e-127	SMART
Pfam:GCC2_GCC3	263	306	6.6e-9	PFAM
FN3	326	418	1.14e-5	SMART
FN3	437	518	4.8e-13	SMART
Pfam:EphA2_TM	543	619	8.2e-25	PFAM
TyrKc	622	879	5.16e-140	SMART
SAM	909	976	1.08e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000231270

Predicted Effect

possibly damaging
Transcript: ENSMUST00000232049
AA Change: R136P

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000232461

Predicted Effect

possibly damaging
Transcript: ENSMUST00000232654
AA Change: R136P

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 48 hours of birth of cardiac failure. Survivors develop normally with no indications of cardiac abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	G	A	4: 88,868,174	T69I	unknown	Het
4930553M12Rik	T	A	4: 88,868,175	T69S	unknown	Het
Acsl6	A	T	11: 54,341,778	Q485L	probably damaging	Het
Adam5	C	A	8: 24,815,480	V81F	probably benign	Het
Armc4	C	T	18: 7,127,229	E995K	probably damaging	Het
Atp5s	A	G	12: 69,741,054	Q88R	probably damaging	Het
Bag2	A	G	1: 33,746,831	S137P	possibly damaging	Het
Birc6	A	T	17: 74,660,413	Q4103L	possibly damaging	Het
Camta2	A	G	11: 70,671,575	F999L	probably benign	Het
Cap2	A	T	13: 46,560,502		probably null	Het
Ccnk	T	A	12: 108,189,090	L102Q	probably null	Het
Cd52	T	C	4: 134,093,737		probably benign	Het
Cdc123	A	T	2: 5,810,806	I160K	probably benign	Het
Cep85l	T	C	10: 53,358,126	N52S	probably benign	Het
Cntnap5a	C	T	1: 116,101,710	T298I	probably benign	Het
Cpsf4	G	T	5: 145,178,762	S192I	probably benign	Het
Cpxm1	A	G	2: 130,397,410	S33P	probably benign	Het
Cyp2a12	A	T	7: 27,034,769	T376S	possibly damaging	Het
Cyp3a16	A	G	5: 145,456,084	F137S	probably damaging	Het
Des	A	G	1: 75,366,804	T444A	probably benign	Het
Dgcr8	C	T	16: 18,284,256	G54D	probably damaging	Het
Doxl2	A	G	6: 48,975,291	H50R	probably benign	Het
Dsc3	A	G	18: 19,980,686	F393S	possibly damaging	Het
Dstyk	T	A	1: 132,463,375	M838K	probably damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Eml5	A	C	12: 98,810,605	F1417C	probably damaging	Het
Ep400	A	T	5: 110,703,518	M1366K	unknown	Het
Epg5	G	T	18: 77,954,197	C425F	possibly damaging	Het
Extl1	C	A	4: 134,371,044	E225D	probably benign	Het
Fam186b	A	G	15: 99,280,657	Y263H	probably benign	Het
Fbn2	A	G	18: 58,052,993	V1761A	possibly damaging	Het
Fer1l6	T	A	15: 58,627,534	M1251K	probably benign	Het
Gart	A	T	16: 91,630,081	I555N	probably damaging	Het
Gm11596	A	T	11: 99,792,963	C110*	probably null	Het
Gnptab	C	T	10: 88,428,506	S262L	possibly damaging	Het
Gpr21	T	C	2: 37,518,231	V263A	probably benign	Het
Gxylt1	T	C	15: 93,254,480	I224V	probably benign	Het
H2-Aa	A	G	17: 34,283,827	S122P	probably damaging	Het
Hsph1	A	C	5: 149,630,337		probably null	Het
Hunk	G	A	16: 90,432,532	D94N	probably damaging	Het
Ikbke	C	A	1: 131,273,474	V176L	probably damaging	Het
Inpp5k	A	T	11: 75,647,191		probably null	Het
Ints10	A	G	8: 68,796,805	T96A	probably damaging	Het
Kansl2	A	T	15: 98,526,631	V306E	probably benign	Het
Kif20a	A	G	18: 34,625,604	D42G	possibly damaging	Het
Klhl7	A	T	5: 24,100,863	M37L	probably benign	Het
Krtap1-5	T	C	11: 99,580,818	I50V	probably benign	Het
Ktn1	A	G	14: 47,714,652	E983G	probably damaging	Het
Lrrk1	G	A	7: 66,296,163	S566L	probably damaging	Het
M6pr	A	G	6: 122,315,367	M174V	probably benign	Het
Man2a2	A	G	7: 80,363,516	S510P	probably damaging	Het
Mmrn1	G	A	6: 60,945,075	S172N	possibly damaging	Het
Mpv17	A	G	5: 31,154,189		probably null	Het
Mrgpra9	T	C	7: 47,235,463	E152G	probably benign	Het
Mst1r	T	C	9: 107,913,168	V660A	probably benign	Het
Myof	A	G	19: 37,981,221		probably null	Het
Myrf	G	A	19: 10,228,674	P126L	probably benign	Het
Nckap1l	C	T	15: 103,475,676	A567V	probably damaging	Het
Nphs1	A	G	7: 30,460,970	E169G	probably benign	Het
Npy1r	T	A	8: 66,705,184	V382D	probably benign	Het
Nrl	A	T	14: 55,520,850	M140K	possibly damaging	Het
Olfr1305	A	G	2: 111,873,423	I144T	probably damaging	Het
Olfr199	C	T	16: 59,216,026	V196M	probably benign	Het
Olfr292	T	A	7: 86,695,280	F275I	probably damaging	Het
Olfr694	A	T	7: 106,688,957	M258K	probably damaging	Het
Olfr924	C	T	9: 38,848,339	T75I	probably damaging	Het
Orc5	T	A	5: 22,547,927	L36F	possibly damaging	Het
Osbpl1a	A	T	18: 12,871,173	S396T	probably benign	Het
Pappa	T	A	4: 65,180,949	Y568*	probably null	Het
Pask	C	T	1: 93,321,297	A794T	probably benign	Het
Pclo	C	T	5: 14,858,752	L5025F	unknown	Het
Pde3a	T	C	6: 141,490,111	V924A	probably benign	Het
Pdpr	A	G	8: 111,118,036	N355S	probably damaging	Het
Pepd	A	T	7: 34,921,418	K36M	probably benign	Het
Pet100	T	G	8: 3,622,355	L14R	probably damaging	Het
Pfkfb2	T	C	1: 130,698,723	T438A	probably benign	Het
Pik3r6	T	A	11: 68,543,611	L546*	probably null	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Plxdc1	T	C	11: 97,934,012	Y339C	probably damaging	Het
Primpol	A	T	8: 46,586,343	M414K	probably damaging	Het
Prol1	A	T	5: 88,328,395	T215S	unknown	Het
Prss22	A	G	17: 23,994,682	Y212H	probably damaging	Het
Ralgapa2	C	A	2: 146,388,604	V1014L	probably damaging	Het
Rap1gap2	G	A	11: 74,425,976	T245M	probably damaging	Het
Rbm26	T	A	14: 105,115,202	R1009*	probably null	Het
Rbm42	A	G	7: 30,641,110	*450Q	probably null	Het
Rere	T	C	4: 150,616,931	V1256A	probably damaging	Het
Rmi1	G	T	13: 58,407,983	L15F	probably damaging	Het
Rnf213	T	C	11: 119,443,690	S3242P	probably damaging	Het
Rtel1	T	A	2: 181,323,706	V167E	probably damaging	Het
Scgb1b2	G	T	7: 31,291,763		probably benign	Het
Sin3b	T	C	8: 72,731,265	L203P	probably damaging	Het
Skint6	T	C	4: 113,236,260	S229G	possibly damaging	Het
Slco1a4	T	C	6: 141,809,378	Y566C	probably damaging	Het
Smgc	T	G	15: 91,844,421	D121E	possibly damaging	Het
Sned1	T	A	1: 93,271,684	F495L	probably damaging	Het
St7	A	T	6: 17,886,007	N52I	possibly damaging	Het
Sycn	C	A	7: 28,541,069	Q54K	probably benign	Het
Syngr4	A	G	7: 45,887,040	V186A	probably benign	Het
Tarsl2	G	A	7: 65,655,791	M254I	possibly damaging	Het
Tcaf2	A	T	6: 42,642,804	H96Q	probably benign	Het
Tcp11l2	T	C	10: 84,613,499	Y443H	probably damaging	Het
Tmem200c	A	T	17: 68,842,249	Q609L	possibly damaging	Het
Tmx3	G	A	18: 90,517,490	G83R	probably damaging	Het
Tpgs2	A	C	18: 25,168,541	V23G	possibly damaging	Het
Trhr	T	C	15: 44,197,183	V33A	probably benign	Het
Trim66	A	T	7: 109,475,113	I647N	probably damaging	Het
Trnt1	A	G	6: 106,778,039	K244E	probably damaging	Het
Tsfm	G	A	10: 127,028,445	Q134*	probably null	Het
Ttll9	A	G	2: 153,003,007	T432A	probably benign	Het
Vmn2r78	C	T	7: 86,954,482	L623F	probably damaging	Het
Wdr55	A	G	18: 36,762,366	N132S	possibly damaging	Het
Wipf2	A	T	11: 98,896,214	R356S	possibly damaging	Het
Wnk1	A	G	6: 119,948,988		probably benign	Het
Zfp260	A	G	7: 30,105,340	K222E	probably damaging	Het
Zfp300	A	G	X: 21,081,951	S525P	possibly damaging	Het
Zfp592	A	G	7: 81,038,202	T959A	probably benign	Het

Other mutations in Epha3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Epha3	APN	16	63566684	missense	probably damaging	1.00
IGL01358:Epha3	APN	16	63595746	splice site	probably benign
IGL01713:Epha3	APN	16	63552562	missense	probably benign	0.00
IGL02371:Epha3	APN	16	63585020	critical splice acceptor site	probably null
IGL03111:Epha3	APN	16	63653446	missense	probably damaging	0.98
IGL03208:Epha3	APN	16	63611089	missense	probably damaging	1.00
laterality	UTSW	16	63568399	missense	probably damaging	1.00
midline	UTSW	16	63844144	missense	possibly damaging	0.46
stride	UTSW	16	63552494	missense	probably benign	0.00
F2404:Epha3	UTSW	16	63546168	missense	probably benign	0.14
P0041:Epha3	UTSW	16	63612868	missense	probably damaging	1.00
PIT4498001:Epha3	UTSW	16	63552526	missense	probably damaging	1.00
PIT4585001:Epha3	UTSW	16	63566577	critical splice donor site	probably null
R0147:Epha3	UTSW	16	63612944	missense	possibly damaging	0.89
R0148:Epha3	UTSW	16	63612944	missense	possibly damaging	0.89
R0336:Epha3	UTSW	16	63566648	missense	probably damaging	1.00
R0738:Epha3	UTSW	16	63595612	missense	probably damaging	1.00
R0833:Epha3	UTSW	16	63603519	splice site	probably benign
R0836:Epha3	UTSW	16	63603519	splice site	probably benign
R0969:Epha3	UTSW	16	63566636	missense	probably damaging	1.00
R1160:Epha3	UTSW	16	63773068	missense	probably damaging	1.00
R1205:Epha3	UTSW	16	63598248	frame shift	probably null
R1349:Epha3	UTSW	16	63611053	missense	possibly damaging	0.89
R1372:Epha3	UTSW	16	63611053	missense	possibly damaging	0.89
R1469:Epha3	UTSW	16	63653494	missense	probably damaging	0.97
R1469:Epha3	UTSW	16	63653494	missense	probably damaging	0.97
R1500:Epha3	UTSW	16	63595662	missense	probably benign	0.06
R1523:Epha3	UTSW	16	63610948	missense	probably damaging	0.99
R1532:Epha3	UTSW	16	63546178	missense	probably benign	0.08
R1544:Epha3	UTSW	16	63773053	missense	probably damaging	1.00
R1681:Epha3	UTSW	16	63595728	missense	probably damaging	1.00
R1708:Epha3	UTSW	16	63583507	missense	probably damaging	1.00
R1803:Epha3	UTSW	16	63602288	missense	probably benign	0.00
R1893:Epha3	UTSW	16	63568399	missense	probably damaging	1.00
R1957:Epha3	UTSW	16	63772952	missense	probably benign	0.00
R2190:Epha3	UTSW	16	63546189	missense	probably benign	0.05
R2198:Epha3	UTSW	16	63844144	missense	possibly damaging	0.46
R2344:Epha3	UTSW	16	63652383	missense	possibly damaging	0.67
R2504:Epha3	UTSW	16	63603625	missense	probably damaging	0.97
R2911:Epha3	UTSW	16	63652412	missense	probably benign
R3889:Epha3	UTSW	16	63610964	missense	probably damaging	1.00
R4223:Epha3	UTSW	16	63583539	missense	probably damaging	0.99
R4836:Epha3	UTSW	16	63583557	missense	probably damaging	1.00
R4981:Epha3	UTSW	16	63652412	missense	probably benign	0.04
R5044:Epha3	UTSW	16	63602287	missense	possibly damaging	0.79
R5195:Epha3	UTSW	16	63546147	missense	possibly damaging	0.86
R5248:Epha3	UTSW	16	63598257	missense	probably damaging	1.00
R5478:Epha3	UTSW	16	63583533	missense	probably damaging	1.00
R6052:Epha3	UTSW	16	63603604	missense	possibly damaging	0.94
R6167:Epha3	UTSW	16	63612924	missense	probably benign	0.00
R6337:Epha3	UTSW	16	63568443	missense	probably damaging	1.00
R6342:Epha3	UTSW	16	63583500	missense	probably damaging	1.00
R6793:Epha3	UTSW	16	63773455	missense	probably benign	0.01
R6908:Epha3	UTSW	16	63598249	missense	probably damaging	1.00
R7029:Epha3	UTSW	16	63773335	missense	probably benign	0.37
R7059:Epha3	UTSW	16	63568455	missense	probably damaging	1.00
R7175:Epha3	UTSW	16	63583500	missense	probably damaging	1.00
R7204:Epha3	UTSW	16	63652332	missense	probably benign
R7217:Epha3	UTSW	16	63552494	missense	probably benign	0.00
R7315:Epha3	UTSW	16	63552609	missense	probably benign	0.00
R7389:Epha3	UTSW	16	63772984	missense	probably damaging	1.00
R7419:Epha3	UTSW	16	63598294	missense	probably damaging	1.00
R7572:Epha3	UTSW	16	63611080	nonsense	probably null
R7667:Epha3	UTSW	16	63566600	missense	probably benign	0.21
R7686:Epha3	UTSW	16	63773288	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTTCACTGTAAACGGGCAC -3'
(R):5'- TGCAATGTCATGGATCACAGC -3'

Sequencing Primer
(F):5'- CGGGCACTTTTTGAAGTACAC -3'
(R):5'- GTCATGGATCACAGCCAAAATAATTG -3'

Posted On

2014-10-01