Incidental Mutation 'R2144:H2-Aa'
ID 236687
Institutional Source Beutler Lab
Gene Symbol H2-Aa
Ensembl Gene ENSMUSG00000036594
Gene Name histocompatibility 2, class II antigen A, alpha
Synonyms H-2Aa, I-Aalpha, Ia-1, Aalpha, Ia1, A alpha
MMRRC Submission 040147-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2144 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34282744-34287827 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34283827 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 122 (S122P)
Ref Sequence ENSEMBL: ENSMUSP00000046105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040655] [ENSMUST00000174751]
AlphaFold no structure available at present
PDB Structure CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION]
Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION]
Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION]
J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION]
J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION]
14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040655
AA Change: S122P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046105
Gene: ENSMUSG00000036594
AA Change: S122P

DomainStartEndE-ValueType
MHC_II_alpha 31 111 1.83e-45 SMART
IGc1 129 200 2.51e-27 SMART
Pfam:C1-set_C 203 255 2.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173944
Predicted Effect probably benign
Transcript: ENSMUST00000174751
AA Change: S39P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133399
Gene: ENSMUSG00000036594
AA Change: S39P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc1 46 117 2.51e-27 SMART
low complexity region 141 158 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cell surface expression of MHC class II molecules on macrophages and show decreased CD4-positive T cell number, increased CD8-positive T cell number, thymus hyperplasia, enlarged lymph nodes, and altered splenocyte response to staphylococcal enterotoxin B. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Acsl6 A T 11: 54,341,778 Q485L probably damaging Het
Adam5 C A 8: 24,815,480 V81F probably benign Het
Armc4 C T 18: 7,127,229 E995K probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Cap2 A T 13: 46,560,502 probably null Het
Ccnk T A 12: 108,189,090 L102Q probably null Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdc123 A T 2: 5,810,806 I160K probably benign Het
Cep85l T C 10: 53,358,126 N52S probably benign Het
Cntnap5a C T 1: 116,101,710 T298I probably benign Het
Cpsf4 G T 5: 145,178,762 S192I probably benign Het
Cpxm1 A G 2: 130,397,410 S33P probably benign Het
Cyp2a12 A T 7: 27,034,769 T376S possibly damaging Het
Cyp3a16 A G 5: 145,456,084 F137S probably damaging Het
Des A G 1: 75,366,804 T444A probably benign Het
Dgcr8 C T 16: 18,284,256 G54D probably damaging Het
Doxl2 A G 6: 48,975,291 H50R probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Ep400 A T 5: 110,703,518 M1366K unknown Het
Epg5 G T 18: 77,954,197 C425F possibly damaging Het
Epha3 C G 16: 63,773,317 R136P possibly damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fam186b A G 15: 99,280,657 Y263H probably benign Het
Fbn2 A G 18: 58,052,993 V1761A possibly damaging Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Gart A T 16: 91,630,081 I555N probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gnptab C T 10: 88,428,506 S262L possibly damaging Het
Gpr21 T C 2: 37,518,231 V263A probably benign Het
Gxylt1 T C 15: 93,254,480 I224V probably benign Het
Hsph1 A C 5: 149,630,337 probably null Het
Hunk G A 16: 90,432,532 D94N probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Ints10 A G 8: 68,796,805 T96A probably damaging Het
Kansl2 A T 15: 98,526,631 V306E probably benign Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Ktn1 A G 14: 47,714,652 E983G probably damaging Het
Lrrk1 G A 7: 66,296,163 S566L probably damaging Het
M6pr A G 6: 122,315,367 M174V probably benign Het
Man2a2 A G 7: 80,363,516 S510P probably damaging Het
Mmrn1 G A 6: 60,945,075 S172N possibly damaging Het
Mpv17 A G 5: 31,154,189 probably null Het
Mrgpra9 T C 7: 47,235,463 E152G probably benign Het
Mst1r T C 9: 107,913,168 V660A probably benign Het
Myof A G 19: 37,981,221 probably null Het
Myrf G A 19: 10,228,674 P126L probably benign Het
Nckap1l C T 15: 103,475,676 A567V probably damaging Het
Nphs1 A G 7: 30,460,970 E169G probably benign Het
Npy1r T A 8: 66,705,184 V382D probably benign Het
Nrl A T 14: 55,520,850 M140K possibly damaging Het
Olfr1305 A G 2: 111,873,423 I144T probably damaging Het
Olfr199 C T 16: 59,216,026 V196M probably benign Het
Olfr292 T A 7: 86,695,280 F275I probably damaging Het
Olfr694 A T 7: 106,688,957 M258K probably damaging Het
Olfr924 C T 9: 38,848,339 T75I probably damaging Het
Orc5 T A 5: 22,547,927 L36F possibly damaging Het
Osbpl1a A T 18: 12,871,173 S396T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pclo C T 5: 14,858,752 L5025F unknown Het
Pde3a T C 6: 141,490,111 V924A probably benign Het
Pdpr A G 8: 111,118,036 N355S probably damaging Het
Pepd A T 7: 34,921,418 K36M probably benign Het
Pet100 T G 8: 3,622,355 L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pik3r6 T A 11: 68,543,611 L546* probably null Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Primpol A T 8: 46,586,343 M414K probably damaging Het
Prol1 A T 5: 88,328,395 T215S unknown Het
Prss22 A G 17: 23,994,682 Y212H probably damaging Het
Ralgapa2 C A 2: 146,388,604 V1014L probably damaging Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rbm26 T A 14: 105,115,202 R1009* probably null Het
Rbm42 A G 7: 30,641,110 *450Q probably null Het
Rere T C 4: 150,616,931 V1256A probably damaging Het
Rmi1 G T 13: 58,407,983 L15F probably damaging Het
Rnf213 T C 11: 119,443,690 S3242P probably damaging Het
Rtel1 T A 2: 181,323,706 V167E probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Sin3b T C 8: 72,731,265 L203P probably damaging Het
Skint6 T C 4: 113,236,260 S229G possibly damaging Het
Slco1a4 T C 6: 141,809,378 Y566C probably damaging Het
Smgc T G 15: 91,844,421 D121E possibly damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
St7 A T 6: 17,886,007 N52I possibly damaging Het
Sycn C A 7: 28,541,069 Q54K probably benign Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tcaf2 A T 6: 42,642,804 H96Q probably benign Het
Tcp11l2 T C 10: 84,613,499 Y443H probably damaging Het
Tmem200c A T 17: 68,842,249 Q609L possibly damaging Het
Tmx3 G A 18: 90,517,490 G83R probably damaging Het
Tpgs2 A C 18: 25,168,541 V23G possibly damaging Het
Trhr T C 15: 44,197,183 V33A probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Trnt1 A G 6: 106,778,039 K244E probably damaging Het
Tsfm G A 10: 127,028,445 Q134* probably null Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vmn2r78 C T 7: 86,954,482 L623F probably damaging Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Wnk1 A G 6: 119,948,988 probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp592 A G 7: 81,038,202 T959A probably benign Het
Other mutations in H2-Aa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:H2-Aa APN 17 34284530 missense probably damaging 1.00
citation UTSW 17 34287677 splice site probably null
reference UTSW 17 34283820 missense probably damaging 1.00
G1citation:H2-Aa UTSW 17 34287677 splice site probably null
R1556:H2-Aa UTSW 17 34284416 missense possibly damaging 0.94
R1901:H2-Aa UTSW 17 34283233 missense possibly damaging 0.65
R4816:H2-Aa UTSW 17 34283820 missense probably damaging 1.00
R5607:H2-Aa UTSW 17 34283842 missense possibly damaging 0.89
R5608:H2-Aa UTSW 17 34283842 missense possibly damaging 0.89
R6264:H2-Aa UTSW 17 34283198 missense probably damaging 0.98
R6822:H2-Aa UTSW 17 34287677 splice site probably null
R6917:H2-Aa UTSW 17 34283707 missense probably damaging 1.00
R7052:H2-Aa UTSW 17 34284510 missense possibly damaging 0.50
R7116:H2-Aa UTSW 17 34283627 nonsense probably null
R8168:H2-Aa UTSW 17 34287721 missense possibly damaging 0.83
R8257:H2-Aa UTSW 17 34283237 missense probably damaging 0.97
R8264:H2-Aa UTSW 17 34287735 missense probably benign 0.18
R8682:H2-Aa UTSW 17 34283760 missense possibly damaging 0.75
R9667:H2-Aa UTSW 17 34283321 missense probably benign
X0063:H2-Aa UTSW 17 34287811 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CACCTTGCAGTCATAAATGTCATC -3'
(R):5'- TGGATGCAGTGCACATTAGC -3'

Sequencing Primer
(F):5'- GCAGTCATAAATGTCATCGTCAG -3'
(R):5'- GTGCACATTAGCTCCAAACAGAAGG -3'
Posted On 2014-10-01