Incidental Mutation 'R2144:Odad2'
ID 236691
Institutional Source Beutler Lab
Gene Symbol Odad2
Ensembl Gene ENSMUSG00000061802
Gene Name outer dynein arm docking complex subunit 2
Synonyms b2b227.1Clo, Armc4, b2b643Clo, 4930463I21Rik
MMRRC Submission 040147-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R2144 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 7088209-7297936 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7127229 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 995 (E995K)
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
AlphaFold B2RY50
Predicted Effect probably damaging
Transcript: ENSMUST00000081275
AA Change: E995K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: E995K

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,412 (GRCm39) T69S unknown Het
4930553M12Rik G A 4: 88,786,411 (GRCm39) T69I unknown Het
Acsl6 A T 11: 54,232,604 (GRCm39) Q485L probably damaging Het
Adam5 C A 8: 25,305,496 (GRCm39) V81F probably benign Het
Aoc1l1 A G 6: 48,952,225 (GRCm39) H50R probably benign Het
Bag2 A G 1: 33,785,912 (GRCm39) S137P possibly damaging Het
Birc6 A T 17: 74,967,408 (GRCm39) Q4103L possibly damaging Het
Camta2 A G 11: 70,562,401 (GRCm39) F999L probably benign Het
Cap2 A T 13: 46,713,978 (GRCm39) probably null Het
Ccnk T A 12: 108,155,349 (GRCm39) L102Q probably null Het
Cd52 T C 4: 133,821,048 (GRCm39) probably benign Het
Cdc123 A T 2: 5,815,617 (GRCm39) I160K probably benign Het
Cep85l T C 10: 53,234,222 (GRCm39) N52S probably benign Het
Cntnap5a C T 1: 116,029,440 (GRCm39) T298I probably benign Het
Cpsf4 G T 5: 145,115,572 (GRCm39) S192I probably benign Het
Cpxm1 A G 2: 130,239,330 (GRCm39) S33P probably benign Het
Cyp2a12 A T 7: 26,734,194 (GRCm39) T376S possibly damaging Het
Cyp3a16 A G 5: 145,392,894 (GRCm39) F137S probably damaging Het
Des A G 1: 75,343,448 (GRCm39) T444A probably benign Het
Dgcr8 C T 16: 18,102,120 (GRCm39) G54D probably damaging Het
Dmac2l A G 12: 69,787,828 (GRCm39) Q88R probably damaging Het
Dsc3 A G 18: 20,113,743 (GRCm39) F393S possibly damaging Het
Dstyk T A 1: 132,391,113 (GRCm39) M838K probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Eml5 A C 12: 98,776,864 (GRCm39) F1417C probably damaging Het
Ep400 A T 5: 110,851,384 (GRCm39) M1366K unknown Het
Epg5 G T 18: 77,997,412 (GRCm39) C425F possibly damaging Het
Epha3 C G 16: 63,593,680 (GRCm39) R136P possibly damaging Het
Extl1 C A 4: 134,098,355 (GRCm39) E225D probably benign Het
Fam186b A G 15: 99,178,538 (GRCm39) Y263H probably benign Het
Fbn2 A G 18: 58,186,065 (GRCm39) V1761A possibly damaging Het
Fer1l6 T A 15: 58,499,383 (GRCm39) M1251K probably benign Het
Gart A T 16: 91,426,969 (GRCm39) I555N probably damaging Het
Gm11596 A T 11: 99,683,789 (GRCm39) C110* probably null Het
Gnptab C T 10: 88,264,368 (GRCm39) S262L possibly damaging Het
Gpr21 T C 2: 37,408,243 (GRCm39) V263A probably benign Het
Gxylt1 T C 15: 93,152,361 (GRCm39) I224V probably benign Het
H2-Aa A G 17: 34,502,801 (GRCm39) S122P probably damaging Het
Hsph1 A C 5: 149,553,802 (GRCm39) probably null Het
Hunk G A 16: 90,229,420 (GRCm39) D94N probably damaging Het
Ikbke C A 1: 131,201,211 (GRCm39) V176L probably damaging Het
Inpp5k A T 11: 75,538,017 (GRCm39) probably null Het
Ints10 A G 8: 69,249,457 (GRCm39) T96A probably damaging Het
Kansl2 A T 15: 98,424,512 (GRCm39) V306E probably benign Het
Kif20a A G 18: 34,758,657 (GRCm39) D42G possibly damaging Het
Klhl7 A T 5: 24,305,861 (GRCm39) M37L probably benign Het
Krtap1-5 T C 11: 99,471,644 (GRCm39) I50V probably benign Het
Ktn1 A G 14: 47,952,109 (GRCm39) E983G probably damaging Het
Lrrk1 G A 7: 65,945,911 (GRCm39) S566L probably damaging Het
M6pr A G 6: 122,292,326 (GRCm39) M174V probably benign Het
Man2a2 A G 7: 80,013,264 (GRCm39) S510P probably damaging Het
Mmrn1 G A 6: 60,922,059 (GRCm39) S172N possibly damaging Het
Mpv17 A G 5: 31,311,533 (GRCm39) probably null Het
Mrgpra9 T C 7: 46,885,211 (GRCm39) E152G probably benign Het
Mst1r T C 9: 107,790,367 (GRCm39) V660A probably benign Het
Myof A G 19: 37,969,669 (GRCm39) probably null Het
Myrf G A 19: 10,206,038 (GRCm39) P126L probably benign Het
Nckap1l C T 15: 103,384,103 (GRCm39) A567V probably damaging Het
Nphs1 A G 7: 30,160,395 (GRCm39) E169G probably benign Het
Npy1r T A 8: 67,157,836 (GRCm39) V382D probably benign Het
Nrl A T 14: 55,758,307 (GRCm39) M140K possibly damaging Het
Or14c39 T A 7: 86,344,488 (GRCm39) F275I probably damaging Het
Or2ag1b A T 7: 106,288,164 (GRCm39) M258K probably damaging Het
Or4f56 A G 2: 111,703,768 (GRCm39) I144T probably damaging Het
Or5ac17 C T 16: 59,036,389 (GRCm39) V196M probably benign Het
Or8d2 C T 9: 38,759,635 (GRCm39) T75I probably damaging Het
Orc5 T A 5: 22,752,925 (GRCm39) L36F possibly damaging Het
Osbpl1a A T 18: 13,004,230 (GRCm39) S396T probably benign Het
Pappa T A 4: 65,099,186 (GRCm39) Y568* probably null Het
Pask C T 1: 93,249,019 (GRCm39) A794T probably benign Het
Pclo C T 5: 14,908,766 (GRCm39) L5025F unknown Het
Pde3a T C 6: 141,435,837 (GRCm39) V924A probably benign Het
Pdpr A G 8: 111,844,668 (GRCm39) N355S probably damaging Het
Pepd A T 7: 34,620,843 (GRCm39) K36M probably benign Het
Pet100 T G 8: 3,672,355 (GRCm39) L14R probably damaging Het
Pfkfb2 T C 1: 130,626,460 (GRCm39) T438A probably benign Het
Pik3r6 T A 11: 68,434,437 (GRCm39) L546* probably null Het
Pira2 A T 7: 3,847,344 (GRCm39) L115Q probably damaging Het
Plxdc1 T C 11: 97,824,838 (GRCm39) Y339C probably damaging Het
Primpol A T 8: 47,039,378 (GRCm39) M414K probably damaging Het
Prol1 A T 5: 88,476,254 (GRCm39) T215S unknown Het
Prss22 A G 17: 24,213,656 (GRCm39) Y212H probably damaging Het
Ralgapa2 C A 2: 146,230,524 (GRCm39) V1014L probably damaging Het
Rap1gap2 G A 11: 74,316,802 (GRCm39) T245M probably damaging Het
Rbm26 T A 14: 105,352,638 (GRCm39) R1009* probably null Het
Rbm42 A G 7: 30,340,535 (GRCm39) *450Q probably null Het
Rere T C 4: 150,701,388 (GRCm39) V1256A probably damaging Het
Rmi1 G T 13: 58,555,797 (GRCm39) L15F probably damaging Het
Rnf213 T C 11: 119,334,516 (GRCm39) S3242P probably damaging Het
Rtel1 T A 2: 180,965,499 (GRCm39) V167E probably damaging Het
Scgb1b2 G T 7: 30,991,188 (GRCm39) probably benign Het
Sin3b T C 8: 73,457,893 (GRCm39) L203P probably damaging Het
Skint6 T C 4: 113,093,457 (GRCm39) S229G possibly damaging Het
Slco1a4 T C 6: 141,755,104 (GRCm39) Y566C probably damaging Het
Smgc T G 15: 91,728,624 (GRCm39) D121E possibly damaging Het
Sned1 T A 1: 93,199,406 (GRCm39) F495L probably damaging Het
St7 A T 6: 17,886,006 (GRCm39) N52I possibly damaging Het
Sycn C A 7: 28,240,494 (GRCm39) Q54K probably benign Het
Syngr4 A G 7: 45,536,464 (GRCm39) V186A probably benign Het
Tars3 G A 7: 65,305,539 (GRCm39) M254I possibly damaging Het
Tcaf2 A T 6: 42,619,738 (GRCm39) H96Q probably benign Het
Tcp11l2 T C 10: 84,449,363 (GRCm39) Y443H probably damaging Het
Tmem200c A T 17: 69,149,244 (GRCm39) Q609L possibly damaging Het
Tmx3 G A 18: 90,535,614 (GRCm39) G83R probably damaging Het
Tpgs2 A C 18: 25,301,598 (GRCm39) V23G possibly damaging Het
Trhr T C 15: 44,060,579 (GRCm39) V33A probably benign Het
Trim66 A T 7: 109,074,320 (GRCm39) I647N probably damaging Het
Trnt1 A G 6: 106,755,000 (GRCm39) K244E probably damaging Het
Tsfm G A 10: 126,864,314 (GRCm39) Q134* probably null Het
Ttll9 A G 2: 152,844,927 (GRCm39) T432A probably benign Het
Vmn2r78 C T 7: 86,603,690 (GRCm39) L623F probably damaging Het
Wdr55 A G 18: 36,895,419 (GRCm39) N132S possibly damaging Het
Wipf2 A T 11: 98,787,040 (GRCm39) R356S possibly damaging Het
Wnk1 A G 6: 119,925,949 (GRCm39) probably benign Het
Zfp260 A G 7: 29,804,765 (GRCm39) K222E probably damaging Het
Zfp300 A G X: 20,948,190 (GRCm39) S525P possibly damaging Het
Zfp592 A G 7: 80,687,950 (GRCm39) T959A probably benign Het
Other mutations in Odad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Odad2 APN 18 7,211,504 (GRCm39) missense probably damaging 0.96
IGL00822:Odad2 APN 18 7,181,817 (GRCm39) missense probably damaging 1.00
IGL01345:Odad2 APN 18 7,266,947 (GRCm39) missense probably benign 0.00
IGL01593:Odad2 APN 18 7,127,345 (GRCm39) missense probably benign 0.00
IGL01645:Odad2 APN 18 7,268,491 (GRCm39) missense probably benign 0.00
IGL01863:Odad2 APN 18 7,222,617 (GRCm39) missense probably damaging 1.00
IGL01955:Odad2 APN 18 7,127,291 (GRCm39) missense possibly damaging 0.89
IGL02013:Odad2 APN 18 7,265,157 (GRCm39) splice site probably benign
IGL02142:Odad2 APN 18 7,214,601 (GRCm39) missense probably damaging 1.00
IGL02399:Odad2 APN 18 7,285,719 (GRCm39) missense probably benign
IGL02439:Odad2 APN 18 7,268,444 (GRCm39) missense probably benign 0.04
IGL02452:Odad2 APN 18 7,129,461 (GRCm39) missense probably damaging 1.00
IGL02632:Odad2 APN 18 7,214,727 (GRCm39) splice site probably benign
IGL03344:Odad2 APN 18 7,129,434 (GRCm39) nonsense probably null
R0062:Odad2 UTSW 18 7,129,593 (GRCm39) splice site probably benign
R0062:Odad2 UTSW 18 7,129,593 (GRCm39) splice site probably benign
R0242:Odad2 UTSW 18 7,211,516 (GRCm39) missense probably damaging 0.96
R0242:Odad2 UTSW 18 7,211,516 (GRCm39) missense probably damaging 0.96
R0365:Odad2 UTSW 18 7,217,800 (GRCm39) missense probably benign 0.01
R0377:Odad2 UTSW 18 7,127,415 (GRCm39) missense probably benign 0.04
R0466:Odad2 UTSW 18 7,286,758 (GRCm39) missense probably benign 0.10
R0517:Odad2 UTSW 18 7,223,621 (GRCm39) missense probably damaging 1.00
R0521:Odad2 UTSW 18 7,222,676 (GRCm39) missense possibly damaging 0.64
R0841:Odad2 UTSW 18 7,268,436 (GRCm39) missense probably damaging 0.99
R1145:Odad2 UTSW 18 7,268,436 (GRCm39) missense probably damaging 0.99
R1145:Odad2 UTSW 18 7,268,436 (GRCm39) missense probably damaging 0.99
R1435:Odad2 UTSW 18 7,222,646 (GRCm39) missense probably benign 0.01
R1487:Odad2 UTSW 18 7,273,245 (GRCm39) missense probably damaging 0.98
R1634:Odad2 UTSW 18 7,286,688 (GRCm39) missense probably damaging 0.99
R1677:Odad2 UTSW 18 7,222,554 (GRCm39) missense probably benign 0.01
R1778:Odad2 UTSW 18 7,127,388 (GRCm39) missense probably damaging 1.00
R1792:Odad2 UTSW 18 7,286,743 (GRCm39) missense probably benign 0.00
R1809:Odad2 UTSW 18 7,211,630 (GRCm39) missense probably benign 0.08
R1842:Odad2 UTSW 18 7,223,551 (GRCm39) missense probably benign 0.04
R2206:Odad2 UTSW 18 7,223,676 (GRCm39) missense probably benign 0.25
R2273:Odad2 UTSW 18 7,223,676 (GRCm39) missense probably benign 0.25
R2275:Odad2 UTSW 18 7,223,676 (GRCm39) missense probably benign 0.25
R2918:Odad2 UTSW 18 7,222,625 (GRCm39) missense probably benign 0.04
R3421:Odad2 UTSW 18 7,223,523 (GRCm39) splice site probably benign
R3422:Odad2 UTSW 18 7,223,523 (GRCm39) splice site probably benign
R4165:Odad2 UTSW 18 7,217,008 (GRCm39) missense probably damaging 1.00
R4225:Odad2 UTSW 18 7,181,732 (GRCm39) critical splice donor site probably null
R4660:Odad2 UTSW 18 7,211,609 (GRCm39) missense possibly damaging 0.88
R4745:Odad2 UTSW 18 7,286,763 (GRCm39) missense probably benign 0.28
R4812:Odad2 UTSW 18 7,288,634 (GRCm39) missense possibly damaging 0.79
R4831:Odad2 UTSW 18 7,222,564 (GRCm39) missense possibly damaging 0.79
R4923:Odad2 UTSW 18 7,181,787 (GRCm39) missense probably damaging 0.97
R4995:Odad2 UTSW 18 7,223,663 (GRCm39) missense probably damaging 1.00
R5024:Odad2 UTSW 18 7,088,555 (GRCm39) missense probably benign 0.02
R5335:Odad2 UTSW 18 7,294,566 (GRCm39) missense probably benign 0.06
R5434:Odad2 UTSW 18 7,222,550 (GRCm39) missense probably benign 0.03
R5552:Odad2 UTSW 18 7,285,360 (GRCm39) missense possibly damaging 0.51
R5719:Odad2 UTSW 18 7,211,496 (GRCm39) missense probably benign 0.00
R5736:Odad2 UTSW 18 7,268,416 (GRCm39) missense probably benign 0.01
R5792:Odad2 UTSW 18 7,217,965 (GRCm39) missense probably benign 0.00
R5848:Odad2 UTSW 18 7,268,507 (GRCm39) splice site probably null
R5957:Odad2 UTSW 18 7,285,706 (GRCm39) missense probably benign 0.01
R6001:Odad2 UTSW 18 7,286,838 (GRCm39) missense probably benign 0.03
R6309:Odad2 UTSW 18 7,214,617 (GRCm39) missense probably benign 0.04
R6559:Odad2 UTSW 18 7,223,664 (GRCm39) missense probably damaging 0.99
R6574:Odad2 UTSW 18 7,129,394 (GRCm39) splice site probably null
R6581:Odad2 UTSW 18 7,129,560 (GRCm39) missense possibly damaging 0.77
R6736:Odad2 UTSW 18 7,223,586 (GRCm39) missense probably damaging 0.98
R6842:Odad2 UTSW 18 7,268,401 (GRCm39) missense probably benign 0.00
R6968:Odad2 UTSW 18 7,273,155 (GRCm39) splice site probably null
R6974:Odad2 UTSW 18 7,294,479 (GRCm39) missense probably benign 0.37
R7024:Odad2 UTSW 18 7,211,593 (GRCm39) missense probably benign 0.43
R7299:Odad2 UTSW 18 7,222,635 (GRCm39) missense probably damaging 1.00
R7578:Odad2 UTSW 18 7,211,593 (GRCm39) missense probably benign 0.43
R7737:Odad2 UTSW 18 7,217,890 (GRCm39) missense probably damaging 1.00
R7878:Odad2 UTSW 18 7,217,801 (GRCm39) missense probably benign 0.01
R8025:Odad2 UTSW 18 7,127,224 (GRCm39) missense probably benign 0.43
R8151:Odad2 UTSW 18 7,127,358 (GRCm39) missense probably damaging 1.00
R8989:Odad2 UTSW 18 7,268,464 (GRCm39) missense probably benign 0.24
R8998:Odad2 UTSW 18 7,211,574 (GRCm39) missense possibly damaging 0.79
R8999:Odad2 UTSW 18 7,211,574 (GRCm39) missense possibly damaging 0.79
R9006:Odad2 UTSW 18 7,294,516 (GRCm39) missense probably benign 0.00
R9091:Odad2 UTSW 18 7,217,846 (GRCm39) nonsense probably null
R9106:Odad2 UTSW 18 7,294,527 (GRCm39) missense probably benign 0.18
R9153:Odad2 UTSW 18 7,286,733 (GRCm39) missense possibly damaging 0.81
R9229:Odad2 UTSW 18 7,127,324 (GRCm39) missense possibly damaging 0.53
R9254:Odad2 UTSW 18 7,265,089 (GRCm39) missense possibly damaging 0.94
R9270:Odad2 UTSW 18 7,217,846 (GRCm39) nonsense probably null
R9379:Odad2 UTSW 18 7,265,089 (GRCm39) missense possibly damaging 0.94
R9626:Odad2 UTSW 18 7,211,422 (GRCm39) nonsense probably null
R9708:Odad2 UTSW 18 7,288,633 (GRCm39) missense probably benign 0.02
Z1088:Odad2 UTSW 18 7,266,919 (GRCm39) missense probably benign
Z1176:Odad2 UTSW 18 7,216,973 (GRCm39) nonsense probably null
Z1176:Odad2 UTSW 18 7,129,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGGGATCCAAACTCAGATC -3'
(R):5'- GCACAGAGTGACTACAGCAC -3'

Sequencing Primer
(F):5'- GGGATCCAAACTCAGATCTCTGTG -3'
(R):5'- ATGACAAGCTGAGGCGTCACC -3'
Posted On 2014-10-01