Mutagenetix > Incidental Mutation

Incidental Mutation 'R2144:Armc4'

236691

Institutional Source

Beutler Lab

Gene Symbol

Armc4

Ensembl Gene

ENSMUSG00000061802

Gene Name

armadillo repeat containing 4

Synonyms

b2b643Clo, 4930463I21Rik, b2b227.1Clo

MMRRC Submission

040147-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.348) question?

Stock #

R2144 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7088233-7297901 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 7127229 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 995 (E995K)

Ref Sequence

ENSEMBL: ENSMUSP00000080028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081275]

AlphaFold

B2RY50

Predicted Effect

probably damaging
Transcript: ENSMUST00000081275
AA Change: E995K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: E995K

Domain	Start	End	E-Value	Type
low complexity region	172	186	N/A	INTRINSIC
low complexity region	410	428	N/A	INTRINSIC
ARM	475	516	1.38e1	SMART
ARM	517	557	2.38e-2	SMART
ARM	558	613	3.97e0	SMART
ARM	614	654	2.59e-3	SMART
ARM	655	695	3.48e1	SMART
ARM	696	737	1.6e1	SMART
ARM	738	778	4.09e0	SMART
ARM	779	819	9.68e0	SMART
ARM	861	903	3.52e0	SMART
ARM	904	944	1.26e1	SMART
ARM	945	985	1.03e1	SMART
ARM	986	1026	1.13e-3	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	G	A	4: 88,868,174	T69I	unknown	Het
4930553M12Rik	T	A	4: 88,868,175	T69S	unknown	Het
Acsl6	A	T	11: 54,341,778	Q485L	probably damaging	Het
Adam5	C	A	8: 24,815,480	V81F	probably benign	Het
Atp5s	A	G	12: 69,741,054	Q88R	probably damaging	Het
Bag2	A	G	1: 33,746,831	S137P	possibly damaging	Het
Birc6	A	T	17: 74,660,413	Q4103L	possibly damaging	Het
Camta2	A	G	11: 70,671,575	F999L	probably benign	Het
Cap2	A	T	13: 46,560,502		probably null	Het
Ccnk	T	A	12: 108,189,090	L102Q	probably null	Het
Cd52	T	C	4: 134,093,737		probably benign	Het
Cdc123	A	T	2: 5,810,806	I160K	probably benign	Het
Cep85l	T	C	10: 53,358,126	N52S	probably benign	Het
Cntnap5a	C	T	1: 116,101,710	T298I	probably benign	Het
Cpsf4	G	T	5: 145,178,762	S192I	probably benign	Het
Cpxm1	A	G	2: 130,397,410	S33P	probably benign	Het
Cyp2a12	A	T	7: 27,034,769	T376S	possibly damaging	Het
Cyp3a16	A	G	5: 145,456,084	F137S	probably damaging	Het
Des	A	G	1: 75,366,804	T444A	probably benign	Het
Dgcr8	C	T	16: 18,284,256	G54D	probably damaging	Het
Doxl2	A	G	6: 48,975,291	H50R	probably benign	Het
Dsc3	A	G	18: 19,980,686	F393S	possibly damaging	Het
Dstyk	T	A	1: 132,463,375	M838K	probably damaging	Het
Dvl1	G	A	4: 155,847,816	V28I	possibly damaging	Het
Eml5	A	C	12: 98,810,605	F1417C	probably damaging	Het
Ep400	A	T	5: 110,703,518	M1366K	unknown	Het
Epg5	G	T	18: 77,954,197	C425F	possibly damaging	Het
Epha3	C	G	16: 63,773,317	R136P	possibly damaging	Het
Extl1	C	A	4: 134,371,044	E225D	probably benign	Het
Fam186b	A	G	15: 99,280,657	Y263H	probably benign	Het
Fbn2	A	G	18: 58,052,993	V1761A	possibly damaging	Het
Fer1l6	T	A	15: 58,627,534	M1251K	probably benign	Het
Gart	A	T	16: 91,630,081	I555N	probably damaging	Het
Gm11596	A	T	11: 99,792,963	C110*	probably null	Het
Gnptab	C	T	10: 88,428,506	S262L	possibly damaging	Het
Gpr21	T	C	2: 37,518,231	V263A	probably benign	Het
Gxylt1	T	C	15: 93,254,480	I224V	probably benign	Het
H2-Aa	A	G	17: 34,283,827	S122P	probably damaging	Het
Hsph1	A	C	5: 149,630,337		probably null	Het
Hunk	G	A	16: 90,432,532	D94N	probably damaging	Het
Ikbke	C	A	1: 131,273,474	V176L	probably damaging	Het
Inpp5k	A	T	11: 75,647,191		probably null	Het
Ints10	A	G	8: 68,796,805	T96A	probably damaging	Het
Kansl2	A	T	15: 98,526,631	V306E	probably benign	Het
Kif20a	A	G	18: 34,625,604	D42G	possibly damaging	Het
Klhl7	A	T	5: 24,100,863	M37L	probably benign	Het
Krtap1-5	T	C	11: 99,580,818	I50V	probably benign	Het
Ktn1	A	G	14: 47,714,652	E983G	probably damaging	Het
Lrrk1	G	A	7: 66,296,163	S566L	probably damaging	Het
M6pr	A	G	6: 122,315,367	M174V	probably benign	Het
Man2a2	A	G	7: 80,363,516	S510P	probably damaging	Het
Mmrn1	G	A	6: 60,945,075	S172N	possibly damaging	Het
Mpv17	A	G	5: 31,154,189		probably null	Het
Mrgpra9	T	C	7: 47,235,463	E152G	probably benign	Het
Mst1r	T	C	9: 107,913,168	V660A	probably benign	Het
Myof	A	G	19: 37,981,221		probably null	Het
Myrf	G	A	19: 10,228,674	P126L	probably benign	Het
Nckap1l	C	T	15: 103,475,676	A567V	probably damaging	Het
Nphs1	A	G	7: 30,460,970	E169G	probably benign	Het
Npy1r	T	A	8: 66,705,184	V382D	probably benign	Het
Nrl	A	T	14: 55,520,850	M140K	possibly damaging	Het
Olfr1305	A	G	2: 111,873,423	I144T	probably damaging	Het
Olfr199	C	T	16: 59,216,026	V196M	probably benign	Het
Olfr292	T	A	7: 86,695,280	F275I	probably damaging	Het
Olfr694	A	T	7: 106,688,957	M258K	probably damaging	Het
Olfr924	C	T	9: 38,848,339	T75I	probably damaging	Het
Orc5	T	A	5: 22,547,927	L36F	possibly damaging	Het
Osbpl1a	A	T	18: 12,871,173	S396T	probably benign	Het
Pappa	T	A	4: 65,180,949	Y568*	probably null	Het
Pask	C	T	1: 93,321,297	A794T	probably benign	Het
Pclo	C	T	5: 14,858,752	L5025F	unknown	Het
Pde3a	T	C	6: 141,490,111	V924A	probably benign	Het
Pdpr	A	G	8: 111,118,036	N355S	probably damaging	Het
Pepd	A	T	7: 34,921,418	K36M	probably benign	Het
Pet100	T	G	8: 3,622,355	L14R	probably damaging	Het
Pfkfb2	T	C	1: 130,698,723	T438A	probably benign	Het
Pik3r6	T	A	11: 68,543,611	L546*	probably null	Het
Pira2	A	T	7: 3,844,345	L115Q	probably damaging	Het
Plxdc1	T	C	11: 97,934,012	Y339C	probably damaging	Het
Primpol	A	T	8: 46,586,343	M414K	probably damaging	Het
Prol1	A	T	5: 88,328,395	T215S	unknown	Het
Prss22	A	G	17: 23,994,682	Y212H	probably damaging	Het
Ralgapa2	C	A	2: 146,388,604	V1014L	probably damaging	Het
Rap1gap2	G	A	11: 74,425,976	T245M	probably damaging	Het
Rbm26	T	A	14: 105,115,202	R1009*	probably null	Het
Rbm42	A	G	7: 30,641,110	*450Q	probably null	Het
Rere	T	C	4: 150,616,931	V1256A	probably damaging	Het
Rmi1	G	T	13: 58,407,983	L15F	probably damaging	Het
Rnf213	T	C	11: 119,443,690	S3242P	probably damaging	Het
Rtel1	T	A	2: 181,323,706	V167E	probably damaging	Het
Scgb1b2	G	T	7: 31,291,763		probably benign	Het
Sin3b	T	C	8: 72,731,265	L203P	probably damaging	Het
Skint6	T	C	4: 113,236,260	S229G	possibly damaging	Het
Slco1a4	T	C	6: 141,809,378	Y566C	probably damaging	Het
Smgc	T	G	15: 91,844,421	D121E	possibly damaging	Het
Sned1	T	A	1: 93,271,684	F495L	probably damaging	Het
St7	A	T	6: 17,886,007	N52I	possibly damaging	Het
Sycn	C	A	7: 28,541,069	Q54K	probably benign	Het
Syngr4	A	G	7: 45,887,040	V186A	probably benign	Het
Tarsl2	G	A	7: 65,655,791	M254I	possibly damaging	Het
Tcaf2	A	T	6: 42,642,804	H96Q	probably benign	Het
Tcp11l2	T	C	10: 84,613,499	Y443H	probably damaging	Het
Tmem200c	A	T	17: 68,842,249	Q609L	possibly damaging	Het
Tmx3	G	A	18: 90,517,490	G83R	probably damaging	Het
Tpgs2	A	C	18: 25,168,541	V23G	possibly damaging	Het
Trhr	T	C	15: 44,197,183	V33A	probably benign	Het
Trim66	A	T	7: 109,475,113	I647N	probably damaging	Het
Trnt1	A	G	6: 106,778,039	K244E	probably damaging	Het
Tsfm	G	A	10: 127,028,445	Q134*	probably null	Het
Ttll9	A	G	2: 153,003,007	T432A	probably benign	Het
Vmn2r78	C	T	7: 86,954,482	L623F	probably damaging	Het
Wdr55	A	G	18: 36,762,366	N132S	possibly damaging	Het
Wipf2	A	T	11: 98,896,214	R356S	possibly damaging	Het
Wnk1	A	G	6: 119,948,988		probably benign	Het
Zfp260	A	G	7: 30,105,340	K222E	probably damaging	Het
Zfp300	A	G	X: 21,081,951	S525P	possibly damaging	Het
Zfp592	A	G	7: 81,038,202	T959A	probably benign	Het

Other mutations in Armc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Armc4	APN	18	7211504	missense	probably damaging	0.96
IGL00822:Armc4	APN	18	7181817	missense	probably damaging	1.00
IGL01345:Armc4	APN	18	7266947	missense	probably benign	0.00
IGL01593:Armc4	APN	18	7127345	missense	probably benign	0.00
IGL01645:Armc4	APN	18	7268491	missense	probably benign	0.00
IGL01863:Armc4	APN	18	7222617	missense	probably damaging	1.00
IGL01955:Armc4	APN	18	7127291	missense	possibly damaging	0.89
IGL02013:Armc4	APN	18	7265157	splice site	probably benign
IGL02142:Armc4	APN	18	7214601	missense	probably damaging	1.00
IGL02399:Armc4	APN	18	7285719	missense	probably benign
IGL02439:Armc4	APN	18	7268444	missense	probably benign	0.04
IGL02452:Armc4	APN	18	7129461	missense	probably damaging	1.00
IGL02632:Armc4	APN	18	7214727	splice site	probably benign
IGL03344:Armc4	APN	18	7129434	nonsense	probably null
R0062:Armc4	UTSW	18	7129593	splice site	probably benign
R0062:Armc4	UTSW	18	7129593	splice site	probably benign
R0242:Armc4	UTSW	18	7211516	missense	probably damaging	0.96
R0242:Armc4	UTSW	18	7211516	missense	probably damaging	0.96
R0365:Armc4	UTSW	18	7217800	missense	probably benign	0.01
R0377:Armc4	UTSW	18	7127415	missense	probably benign	0.04
R0466:Armc4	UTSW	18	7286758	missense	probably benign	0.10
R0517:Armc4	UTSW	18	7223621	missense	probably damaging	1.00
R0521:Armc4	UTSW	18	7222676	missense	possibly damaging	0.64
R0841:Armc4	UTSW	18	7268436	missense	probably damaging	0.99
R1145:Armc4	UTSW	18	7268436	missense	probably damaging	0.99
R1145:Armc4	UTSW	18	7268436	missense	probably damaging	0.99
R1435:Armc4	UTSW	18	7222646	missense	probably benign	0.01
R1487:Armc4	UTSW	18	7273245	missense	probably damaging	0.98
R1634:Armc4	UTSW	18	7286688	missense	probably damaging	0.99
R1677:Armc4	UTSW	18	7222554	missense	probably benign	0.01
R1778:Armc4	UTSW	18	7127388	missense	probably damaging	1.00
R1792:Armc4	UTSW	18	7286743	missense	probably benign	0.00
R1809:Armc4	UTSW	18	7211630	missense	probably benign	0.08
R1842:Armc4	UTSW	18	7223551	missense	probably benign	0.04
R2206:Armc4	UTSW	18	7223676	missense	probably benign	0.25
R2273:Armc4	UTSW	18	7223676	missense	probably benign	0.25
R2275:Armc4	UTSW	18	7223676	missense	probably benign	0.25
R2918:Armc4	UTSW	18	7222625	missense	probably benign	0.04
R3421:Armc4	UTSW	18	7223523	splice site	probably benign
R3422:Armc4	UTSW	18	7223523	splice site	probably benign
R4165:Armc4	UTSW	18	7217008	missense	probably damaging	1.00
R4225:Armc4	UTSW	18	7181732	critical splice donor site	probably null
R4660:Armc4	UTSW	18	7211609	missense	possibly damaging	0.88
R4745:Armc4	UTSW	18	7286763	missense	probably benign	0.28
R4812:Armc4	UTSW	18	7288634	missense	possibly damaging	0.79
R4831:Armc4	UTSW	18	7222564	missense	possibly damaging	0.79
R4923:Armc4	UTSW	18	7181787	missense	probably damaging	0.97
R4995:Armc4	UTSW	18	7223663	missense	probably damaging	1.00
R5024:Armc4	UTSW	18	7088555	missense	probably benign	0.02
R5335:Armc4	UTSW	18	7294566	missense	probably benign	0.06
R5434:Armc4	UTSW	18	7222550	missense	probably benign	0.03
R5552:Armc4	UTSW	18	7285360	missense	possibly damaging	0.51
R5719:Armc4	UTSW	18	7211496	missense	probably benign	0.00
R5736:Armc4	UTSW	18	7268416	missense	probably benign	0.01
R5792:Armc4	UTSW	18	7217965	missense	probably benign	0.00
R5848:Armc4	UTSW	18	7268507	splice site	probably null
R5957:Armc4	UTSW	18	7285706	missense	probably benign	0.01
R6001:Armc4	UTSW	18	7286838	missense	probably benign	0.03
R6309:Armc4	UTSW	18	7214617	missense	probably benign	0.04
R6559:Armc4	UTSW	18	7223664	missense	probably damaging	0.99
R6574:Armc4	UTSW	18	7129394	splice site	probably null
R6581:Armc4	UTSW	18	7129560	missense	possibly damaging	0.77
R6736:Armc4	UTSW	18	7223586	missense	probably damaging	0.98
R6842:Armc4	UTSW	18	7268401	missense	probably benign	0.00
R6968:Armc4	UTSW	18	7273155	splice site	probably null
R6974:Armc4	UTSW	18	7294479	missense	probably benign	0.37
R7024:Armc4	UTSW	18	7211593	missense	probably benign	0.43
R7299:Armc4	UTSW	18	7222635	missense	probably damaging	1.00
R7578:Armc4	UTSW	18	7211593	missense	probably benign	0.43
R7737:Armc4	UTSW	18	7217890	missense	probably damaging	1.00
R7878:Armc4	UTSW	18	7217801	missense	probably benign	0.01
R8025:Armc4	UTSW	18	7127224	missense	probably benign	0.43
R8151:Armc4	UTSW	18	7127358	missense	probably damaging	1.00
R8989:Armc4	UTSW	18	7268464	missense	probably benign	0.24
R8998:Armc4	UTSW	18	7211574	missense	possibly damaging	0.79
R8999:Armc4	UTSW	18	7211574	missense	possibly damaging	0.79
R9006:Armc4	UTSW	18	7294516	missense	probably benign	0.00
R9091:Armc4	UTSW	18	7217846	nonsense	probably null
R9106:Armc4	UTSW	18	7294527	missense	probably benign	0.18
R9153:Armc4	UTSW	18	7286733	missense	possibly damaging	0.81
R9229:Armc4	UTSW	18	7127324	missense	possibly damaging	0.53
R9254:Armc4	UTSW	18	7265089	missense	possibly damaging	0.94
R9270:Armc4	UTSW	18	7217846	nonsense	probably null
R9379:Armc4	UTSW	18	7265089	missense	possibly damaging	0.94
R9626:Armc4	UTSW	18	7211422	nonsense	probably null
R9708:Armc4	UTSW	18	7288633	missense	probably benign	0.02
Z1088:Armc4	UTSW	18	7266919	missense	probably benign
Z1176:Armc4	UTSW	18	7129487	missense	probably damaging	1.00
Z1176:Armc4	UTSW	18	7216973	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTCCTGGGATCCAAACTCAGATC -3'
(R):5'- GCACAGAGTGACTACAGCAC -3'

Sequencing Primer
(F):5'- GGGATCCAAACTCAGATCTCTGTG -3'
(R):5'- ATGACAAGCTGAGGCGTCACC -3'

Posted On

2014-10-01