Incidental Mutation 'R2144:Myof'
ID 236702
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Name myoferlin
Synonyms E030042N20Rik, 2310051D19Rik, Fer1l3
MMRRC Submission 040147-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2144 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 37887484-38032025 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 37969669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000226068]
AlphaFold Q69ZN7
Predicted Effect probably null
Transcript: ENSMUST00000041475
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172095
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223650
Predicted Effect probably null
Transcript: ENSMUST00000226068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226084
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,412 (GRCm39) T69S unknown Het
4930553M12Rik G A 4: 88,786,411 (GRCm39) T69I unknown Het
Acsl6 A T 11: 54,232,604 (GRCm39) Q485L probably damaging Het
Adam5 C A 8: 25,305,496 (GRCm39) V81F probably benign Het
Aoc1l1 A G 6: 48,952,225 (GRCm39) H50R probably benign Het
Bag2 A G 1: 33,785,912 (GRCm39) S137P possibly damaging Het
Birc6 A T 17: 74,967,408 (GRCm39) Q4103L possibly damaging Het
Camta2 A G 11: 70,562,401 (GRCm39) F999L probably benign Het
Cap2 A T 13: 46,713,978 (GRCm39) probably null Het
Ccnk T A 12: 108,155,349 (GRCm39) L102Q probably null Het
Cd52 T C 4: 133,821,048 (GRCm39) probably benign Het
Cdc123 A T 2: 5,815,617 (GRCm39) I160K probably benign Het
Cep85l T C 10: 53,234,222 (GRCm39) N52S probably benign Het
Cntnap5a C T 1: 116,029,440 (GRCm39) T298I probably benign Het
Cpsf4 G T 5: 145,115,572 (GRCm39) S192I probably benign Het
Cpxm1 A G 2: 130,239,330 (GRCm39) S33P probably benign Het
Cyp2a12 A T 7: 26,734,194 (GRCm39) T376S possibly damaging Het
Cyp3a16 A G 5: 145,392,894 (GRCm39) F137S probably damaging Het
Des A G 1: 75,343,448 (GRCm39) T444A probably benign Het
Dgcr8 C T 16: 18,102,120 (GRCm39) G54D probably damaging Het
Dmac2l A G 12: 69,787,828 (GRCm39) Q88R probably damaging Het
Dsc3 A G 18: 20,113,743 (GRCm39) F393S possibly damaging Het
Dstyk T A 1: 132,391,113 (GRCm39) M838K probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Eml5 A C 12: 98,776,864 (GRCm39) F1417C probably damaging Het
Ep400 A T 5: 110,851,384 (GRCm39) M1366K unknown Het
Epg5 G T 18: 77,997,412 (GRCm39) C425F possibly damaging Het
Epha3 C G 16: 63,593,680 (GRCm39) R136P possibly damaging Het
Extl1 C A 4: 134,098,355 (GRCm39) E225D probably benign Het
Fam186b A G 15: 99,178,538 (GRCm39) Y263H probably benign Het
Fbn2 A G 18: 58,186,065 (GRCm39) V1761A possibly damaging Het
Fer1l6 T A 15: 58,499,383 (GRCm39) M1251K probably benign Het
Gart A T 16: 91,426,969 (GRCm39) I555N probably damaging Het
Gm11596 A T 11: 99,683,789 (GRCm39) C110* probably null Het
Gnptab C T 10: 88,264,368 (GRCm39) S262L possibly damaging Het
Gpr21 T C 2: 37,408,243 (GRCm39) V263A probably benign Het
Gxylt1 T C 15: 93,152,361 (GRCm39) I224V probably benign Het
H2-Aa A G 17: 34,502,801 (GRCm39) S122P probably damaging Het
Hsph1 A C 5: 149,553,802 (GRCm39) probably null Het
Hunk G A 16: 90,229,420 (GRCm39) D94N probably damaging Het
Ikbke C A 1: 131,201,211 (GRCm39) V176L probably damaging Het
Inpp5k A T 11: 75,538,017 (GRCm39) probably null Het
Ints10 A G 8: 69,249,457 (GRCm39) T96A probably damaging Het
Kansl2 A T 15: 98,424,512 (GRCm39) V306E probably benign Het
Kif20a A G 18: 34,758,657 (GRCm39) D42G possibly damaging Het
Klhl7 A T 5: 24,305,861 (GRCm39) M37L probably benign Het
Krtap1-5 T C 11: 99,471,644 (GRCm39) I50V probably benign Het
Ktn1 A G 14: 47,952,109 (GRCm39) E983G probably damaging Het
Lrrk1 G A 7: 65,945,911 (GRCm39) S566L probably damaging Het
M6pr A G 6: 122,292,326 (GRCm39) M174V probably benign Het
Man2a2 A G 7: 80,013,264 (GRCm39) S510P probably damaging Het
Mmrn1 G A 6: 60,922,059 (GRCm39) S172N possibly damaging Het
Mpv17 A G 5: 31,311,533 (GRCm39) probably null Het
Mrgpra9 T C 7: 46,885,211 (GRCm39) E152G probably benign Het
Mst1r T C 9: 107,790,367 (GRCm39) V660A probably benign Het
Myrf G A 19: 10,206,038 (GRCm39) P126L probably benign Het
Nckap1l C T 15: 103,384,103 (GRCm39) A567V probably damaging Het
Nphs1 A G 7: 30,160,395 (GRCm39) E169G probably benign Het
Npy1r T A 8: 67,157,836 (GRCm39) V382D probably benign Het
Nrl A T 14: 55,758,307 (GRCm39) M140K possibly damaging Het
Odad2 C T 18: 7,127,229 (GRCm39) E995K probably damaging Het
Or14c39 T A 7: 86,344,488 (GRCm39) F275I probably damaging Het
Or2ag1b A T 7: 106,288,164 (GRCm39) M258K probably damaging Het
Or4f56 A G 2: 111,703,768 (GRCm39) I144T probably damaging Het
Or5ac17 C T 16: 59,036,389 (GRCm39) V196M probably benign Het
Or8d2 C T 9: 38,759,635 (GRCm39) T75I probably damaging Het
Orc5 T A 5: 22,752,925 (GRCm39) L36F possibly damaging Het
Osbpl1a A T 18: 13,004,230 (GRCm39) S396T probably benign Het
Pappa T A 4: 65,099,186 (GRCm39) Y568* probably null Het
Pask C T 1: 93,249,019 (GRCm39) A794T probably benign Het
Pclo C T 5: 14,908,766 (GRCm39) L5025F unknown Het
Pde3a T C 6: 141,435,837 (GRCm39) V924A probably benign Het
Pdpr A G 8: 111,844,668 (GRCm39) N355S probably damaging Het
Pepd A T 7: 34,620,843 (GRCm39) K36M probably benign Het
Pet100 T G 8: 3,672,355 (GRCm39) L14R probably damaging Het
Pfkfb2 T C 1: 130,626,460 (GRCm39) T438A probably benign Het
Pik3r6 T A 11: 68,434,437 (GRCm39) L546* probably null Het
Pira2 A T 7: 3,847,344 (GRCm39) L115Q probably damaging Het
Plxdc1 T C 11: 97,824,838 (GRCm39) Y339C probably damaging Het
Primpol A T 8: 47,039,378 (GRCm39) M414K probably damaging Het
Prol1 A T 5: 88,476,254 (GRCm39) T215S unknown Het
Prss22 A G 17: 24,213,656 (GRCm39) Y212H probably damaging Het
Ralgapa2 C A 2: 146,230,524 (GRCm39) V1014L probably damaging Het
Rap1gap2 G A 11: 74,316,802 (GRCm39) T245M probably damaging Het
Rbm26 T A 14: 105,352,638 (GRCm39) R1009* probably null Het
Rbm42 A G 7: 30,340,535 (GRCm39) *450Q probably null Het
Rere T C 4: 150,701,388 (GRCm39) V1256A probably damaging Het
Rmi1 G T 13: 58,555,797 (GRCm39) L15F probably damaging Het
Rnf213 T C 11: 119,334,516 (GRCm39) S3242P probably damaging Het
Rtel1 T A 2: 180,965,499 (GRCm39) V167E probably damaging Het
Scgb1b2 G T 7: 30,991,188 (GRCm39) probably benign Het
Sin3b T C 8: 73,457,893 (GRCm39) L203P probably damaging Het
Skint6 T C 4: 113,093,457 (GRCm39) S229G possibly damaging Het
Slco1a4 T C 6: 141,755,104 (GRCm39) Y566C probably damaging Het
Smgc T G 15: 91,728,624 (GRCm39) D121E possibly damaging Het
Sned1 T A 1: 93,199,406 (GRCm39) F495L probably damaging Het
St7 A T 6: 17,886,006 (GRCm39) N52I possibly damaging Het
Sycn C A 7: 28,240,494 (GRCm39) Q54K probably benign Het
Syngr4 A G 7: 45,536,464 (GRCm39) V186A probably benign Het
Tars3 G A 7: 65,305,539 (GRCm39) M254I possibly damaging Het
Tcaf2 A T 6: 42,619,738 (GRCm39) H96Q probably benign Het
Tcp11l2 T C 10: 84,449,363 (GRCm39) Y443H probably damaging Het
Tmem200c A T 17: 69,149,244 (GRCm39) Q609L possibly damaging Het
Tmx3 G A 18: 90,535,614 (GRCm39) G83R probably damaging Het
Tpgs2 A C 18: 25,301,598 (GRCm39) V23G possibly damaging Het
Trhr T C 15: 44,060,579 (GRCm39) V33A probably benign Het
Trim66 A T 7: 109,074,320 (GRCm39) I647N probably damaging Het
Trnt1 A G 6: 106,755,000 (GRCm39) K244E probably damaging Het
Tsfm G A 10: 126,864,314 (GRCm39) Q134* probably null Het
Ttll9 A G 2: 152,844,927 (GRCm39) T432A probably benign Het
Vmn2r78 C T 7: 86,603,690 (GRCm39) L623F probably damaging Het
Wdr55 A G 18: 36,895,419 (GRCm39) N132S possibly damaging Het
Wipf2 A T 11: 98,787,040 (GRCm39) R356S possibly damaging Het
Wnk1 A G 6: 119,925,949 (GRCm39) probably benign Het
Zfp260 A G 7: 29,804,765 (GRCm39) K222E probably damaging Het
Zfp300 A G X: 20,948,190 (GRCm39) S525P possibly damaging Het
Zfp592 A G 7: 80,687,950 (GRCm39) T959A probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37,949,382 (GRCm39) missense probably benign 0.16
IGL00764:Myof APN 19 37,963,371 (GRCm39) missense probably benign 0.04
IGL00801:Myof APN 19 37,974,521 (GRCm39) missense probably damaging 0.99
IGL01084:Myof APN 19 37,924,884 (GRCm39) missense probably damaging 1.00
IGL01368:Myof APN 19 37,924,905 (GRCm39) missense probably damaging 0.97
IGL01472:Myof APN 19 37,911,524 (GRCm39) missense probably benign
IGL01785:Myof APN 19 37,968,871 (GRCm39) nonsense probably null
IGL02205:Myof APN 19 37,913,083 (GRCm39) missense probably damaging 1.00
IGL02268:Myof APN 19 37,963,311 (GRCm39) missense possibly damaging 0.90
IGL02268:Myof APN 19 37,942,877 (GRCm39) missense possibly damaging 0.50
IGL02339:Myof APN 19 37,960,661 (GRCm39) missense possibly damaging 0.46
IGL02433:Myof APN 19 37,960,641 (GRCm39) missense probably benign 0.05
IGL02481:Myof APN 19 37,926,361 (GRCm39) nonsense probably null
IGL02536:Myof APN 19 37,938,103 (GRCm39) missense probably damaging 0.97
IGL02682:Myof APN 19 37,909,929 (GRCm39) missense probably benign 0.09
IGL02732:Myof APN 19 37,966,164 (GRCm39) missense possibly damaging 0.50
IGL02887:Myof APN 19 37,909,227 (GRCm39) critical splice acceptor site probably null
IGL03114:Myof APN 19 37,892,309 (GRCm39) missense probably damaging 1.00
IGL03137:Myof APN 19 37,963,337 (GRCm39) missense probably damaging 1.00
IGL03340:Myof APN 19 37,899,607 (GRCm39) missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37,971,406 (GRCm39) critical splice donor site probably null
R0024:Myof UTSW 19 37,904,188 (GRCm39) missense probably damaging 0.98
R0140:Myof UTSW 19 37,940,004 (GRCm39) nonsense probably null
R0309:Myof UTSW 19 37,969,714 (GRCm39) missense probably benign 0.12
R0330:Myof UTSW 19 37,924,326 (GRCm39) missense probably damaging 1.00
R0345:Myof UTSW 19 38,012,793 (GRCm39) missense probably damaging 1.00
R0349:Myof UTSW 19 37,899,417 (GRCm39) missense probably damaging 0.99
R0463:Myof UTSW 19 37,904,952 (GRCm39) missense probably damaging 1.00
R0507:Myof UTSW 19 37,889,725 (GRCm39) missense possibly damaging 0.94
R0512:Myof UTSW 19 37,942,972 (GRCm39) missense possibly damaging 0.54
R0608:Myof UTSW 19 37,904,952 (GRCm39) missense probably damaging 1.00
R0723:Myof UTSW 19 37,969,708 (GRCm39) missense probably damaging 1.00
R1081:Myof UTSW 19 37,974,536 (GRCm39) missense probably damaging 0.99
R1196:Myof UTSW 19 37,899,408 (GRCm39) missense probably damaging 1.00
R1243:Myof UTSW 19 37,924,540 (GRCm39) missense probably damaging 1.00
R1371:Myof UTSW 19 37,892,116 (GRCm39) splice site probably benign
R1381:Myof UTSW 19 37,983,933 (GRCm39) missense probably damaging 1.00
R1419:Myof UTSW 19 37,890,359 (GRCm39) missense probably damaging 1.00
R1527:Myof UTSW 19 37,913,067 (GRCm39) missense probably damaging 1.00
R1672:Myof UTSW 19 37,931,927 (GRCm39) missense probably damaging 1.00
R1864:Myof UTSW 19 37,975,153 (GRCm39) missense probably benign
R1914:Myof UTSW 19 37,966,141 (GRCm39) missense probably damaging 1.00
R1915:Myof UTSW 19 37,966,141 (GRCm39) missense probably damaging 1.00
R1970:Myof UTSW 19 37,934,082 (GRCm39) missense probably damaging 0.99
R2062:Myof UTSW 19 37,904,194 (GRCm39) missense possibly damaging 0.94
R2243:Myof UTSW 19 37,889,767 (GRCm39) missense probably damaging 1.00
R2339:Myof UTSW 19 37,926,375 (GRCm39) missense probably damaging 1.00
R2484:Myof UTSW 19 37,892,291 (GRCm39) missense probably benign 0.13
R2880:Myof UTSW 19 37,911,473 (GRCm39) missense probably benign 0.04
R3418:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R3967:Myof UTSW 19 38,011,058 (GRCm39) missense possibly damaging 0.59
R3967:Myof UTSW 19 37,889,711 (GRCm39) missense probably damaging 1.00
R3970:Myof UTSW 19 38,011,058 (GRCm39) missense possibly damaging 0.59
R3970:Myof UTSW 19 37,889,711 (GRCm39) missense probably damaging 1.00
R4238:Myof UTSW 19 37,911,456 (GRCm39) nonsense probably null
R4405:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4406:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4407:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4408:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4561:Myof UTSW 19 37,911,438 (GRCm39) missense probably benign
R4606:Myof UTSW 19 37,955,547 (GRCm39) missense probably damaging 1.00
R4778:Myof UTSW 19 37,938,011 (GRCm39) missense probably damaging 1.00
R4801:Myof UTSW 19 37,934,186 (GRCm39) missense probably benign 0.24
R4802:Myof UTSW 19 37,934,186 (GRCm39) missense probably benign 0.24
R4812:Myof UTSW 19 37,905,007 (GRCm39) missense probably damaging 1.00
R4884:Myof UTSW 19 37,930,805 (GRCm39) missense probably damaging 1.00
R4964:Myof UTSW 19 37,924,300 (GRCm39) missense probably damaging 0.97
R4966:Myof UTSW 19 37,924,300 (GRCm39) missense probably damaging 0.97
R5069:Myof UTSW 19 37,893,773 (GRCm39) missense possibly damaging 0.65
R5181:Myof UTSW 19 37,921,071 (GRCm39) missense possibly damaging 0.95
R5376:Myof UTSW 19 37,904,848 (GRCm39) missense probably damaging 1.00
R5384:Myof UTSW 19 37,941,435 (GRCm39) missense probably damaging 0.98
R5543:Myof UTSW 19 37,969,778 (GRCm39) missense probably benign 0.00
R5626:Myof UTSW 19 37,911,438 (GRCm39) missense probably benign
R5865:Myof UTSW 19 37,899,382 (GRCm39) missense probably damaging 1.00
R5919:Myof UTSW 19 38,012,818 (GRCm39) missense possibly damaging 0.95
R5924:Myof UTSW 19 37,971,421 (GRCm39) missense probably damaging 0.97
R5997:Myof UTSW 19 37,893,747 (GRCm39) missense possibly damaging 0.90
R5999:Myof UTSW 19 37,928,304 (GRCm39) nonsense probably null
R6039:Myof UTSW 19 37,966,132 (GRCm39) missense probably damaging 1.00
R6039:Myof UTSW 19 37,966,132 (GRCm39) missense probably damaging 1.00
R6041:Myof UTSW 19 37,913,068 (GRCm39) missense probably damaging 1.00
R6051:Myof UTSW 19 38,012,809 (GRCm39) missense probably damaging 1.00
R6057:Myof UTSW 19 37,915,429 (GRCm39) critical splice donor site probably null
R6089:Myof UTSW 19 37,955,508 (GRCm39) missense probably benign 0.37
R6195:Myof UTSW 19 37,901,805 (GRCm39) missense possibly damaging 0.89
R6478:Myof UTSW 19 37,892,279 (GRCm39) missense probably damaging 1.00
R6545:Myof UTSW 19 37,930,745 (GRCm39) missense possibly damaging 0.67
R6655:Myof UTSW 19 37,923,239 (GRCm39) missense probably damaging 1.00
R6715:Myof UTSW 19 37,956,794 (GRCm39) missense probably benign 0.04
R6737:Myof UTSW 19 37,931,962 (GRCm39) missense probably benign 0.01
R6837:Myof UTSW 19 37,911,404 (GRCm39) critical splice donor site probably null
R7096:Myof UTSW 19 37,924,648 (GRCm39) missense probably damaging 1.00
R7308:Myof UTSW 19 37,899,359 (GRCm39) missense probably damaging 0.98
R7328:Myof UTSW 19 37,904,847 (GRCm39) missense probably damaging 1.00
R7485:Myof UTSW 19 37,939,939 (GRCm39) nonsense probably null
R7554:Myof UTSW 19 37,942,958 (GRCm39) missense probably benign 0.09
R7759:Myof UTSW 19 37,928,346 (GRCm39) missense probably benign 0.00
R7779:Myof UTSW 19 37,927,838 (GRCm39) missense probably damaging 1.00
R8116:Myof UTSW 19 37,921,167 (GRCm39) missense probably damaging 0.99
R8264:Myof UTSW 19 37,909,881 (GRCm39) missense probably damaging 1.00
R8415:Myof UTSW 19 37,983,872 (GRCm39) missense probably benign
R8756:Myof UTSW 19 37,928,400 (GRCm39) missense probably benign
R8777:Myof UTSW 19 37,968,841 (GRCm39) missense probably benign 0.01
R8777-TAIL:Myof UTSW 19 37,968,841 (GRCm39) missense probably benign 0.01
R8835:Myof UTSW 19 37,955,547 (GRCm39) missense possibly damaging 0.92
R9046:Myof UTSW 19 37,923,112 (GRCm39) intron probably benign
R9396:Myof UTSW 19 37,923,294 (GRCm39) missense probably damaging 1.00
R9415:Myof UTSW 19 37,941,412 (GRCm39) missense probably damaging 1.00
R9450:Myof UTSW 19 37,949,374 (GRCm39) missense probably damaging 1.00
R9451:Myof UTSW 19 37,966,096 (GRCm39) critical splice donor site probably null
R9537:Myof UTSW 19 37,896,054 (GRCm39) missense probably damaging 1.00
R9592:Myof UTSW 19 38,031,737 (GRCm39) missense probably damaging 0.99
R9616:Myof UTSW 19 37,923,263 (GRCm39) missense possibly damaging 0.52
R9751:Myof UTSW 19 37,924,818 (GRCm39) missense probably benign
X0024:Myof UTSW 19 37,963,045 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCATGGAAGATGAACTCAAGCC -3'
(R):5'- AATCAGGATCCTGCCAGCAC -3'

Sequencing Primer
(F):5'- CAACTTGAGCTGTATGAGACCCTG -3'
(R):5'- AGCACATCTTTAGAGTGGCC -3'
Posted On 2014-10-01