Mutagenetix > Incidental Mutations

Incidental Mutation 'R2162:Hlx'

236706

Institutional Source

Beutler Lab

Gene Symbol

Hlx

Ensembl Gene

ENSMUSG00000039377

Gene Name

H2.0-like homeobox

Synonyms

Hlx1

MMRRC Submission

040165-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

184727140-184732619 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 184730692 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000040505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048572] [ENSMUST00000174257]

Predicted Effect

probably null
Transcript: ENSMUST00000048572

SMART Domains

Protein: ENSMUSP00000040505
Gene: ENSMUSG00000039377

Domain	Start	End	E-Value	Type
low complexity region	52	63	N/A	INTRINSIC
low complexity region	123	149	N/A	INTRINSIC
low complexity region	157	168	N/A	INTRINSIC
HOX	271	335	2.32e-22	SMART
low complexity region	353	379	N/A	INTRINSIC
low complexity region	405	434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174257

SMART Domains

Protein: ENSMUSP00000134728
Gene: ENSMUSG00000039377

Domain	Start	End	E-Value	Type
low complexity region	52	63	N/A	INTRINSIC
low complexity region	123	149	N/A	INTRINSIC
low complexity region	157	168	N/A	INTRINSIC
low complexity region	221	271	N/A	INTRINSIC
low complexity region	344	357	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (55/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for disrputions in this gene die as embryos as a result of defective organogenesis and fetal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,972,238	T524A	possibly damaging	Het
Adamts20	A	C	15: 94,331,458	C927G	probably damaging	Het
Afdn	T	A	17: 13,896,174	D190E	probably benign	Het
Ankrd28	T	C	14: 31,708,762	D850G	probably damaging	Het
Arhgap45	T	C	10: 80,016,979	M1T	probably null	Het
Atp6v0a4	T	G	6: 38,088,646	K128N	possibly damaging	Het
Bcat1	T	A	6: 145,010,108	D349V	probably damaging	Het
Cacna1i	T	C	15: 80,356,187	F370S	probably damaging	Het
Clca4b	T	C	3: 144,928,587	I82V	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cyfip2	T	C	11: 46,261,506	D485G	probably benign	Het
Cyp27b1	G	T	10: 127,051,060	V382L	probably damaging	Het
Dnaaf5	T	C	5: 139,181,565	V447A	possibly damaging	Het
Dpp9	A	T	17: 56,199,113	F429I	possibly damaging	Het
Eng	C	T	2: 32,679,047	R528C	probably damaging	Het
Gcn1l1	A	T	5: 115,592,132	Q835L	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Htt	T	A	5: 34,821,718	V815D	probably benign	Het
Il1f5	G	T	2: 24,279,680	L17F	probably damaging	Het
Itga1	C	T	13: 115,030,910	V157I	probably benign	Het
Krtap19-3	T	G	16: 88,877,719	*88C	probably null	Het
Lzic	G	C	4: 149,488,728	E112D	probably null	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Mep1b	C	T	18: 21,086,239	T150I	possibly damaging	Het
Mroh7	G	C	4: 106,700,181	S777R	probably damaging	Het
Nrxn1	G	A	17: 90,162,431	R35C	probably damaging	Het
Olfr1145	T	A	2: 87,810,360	I180K	probably damaging	Het
Olfr494	C	A	7: 108,367,562	P24Q	probably benign	Het
Olfr624	T	G	7: 103,670,872	Q53P	possibly damaging	Het
Pacs2	A	G	12: 113,050,947	T243A	probably benign	Het
Pan2	A	G	10: 128,304,222	E4G	possibly damaging	Het
Pdp1	A	G	4: 11,961,123	V396A	probably damaging	Het
Pdzd7	A	G	19: 45,036,055		probably null	Het
Peg10	T	A	6: 4,755,914		probably benign	Het
Pgc	C	A	17: 47,729,311	F93L	probably null	Het
Piezo2	A	G	18: 63,081,662		probably null	Het
Pja2	T	C	17: 64,309,402	D166G	probably benign	Het
Ppp1r9b	T	C	11: 94,998,051	L97P	probably damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
S100a10	T	C	3: 93,564,373	V88A	probably damaging	Het
Scn9a	T	A	2: 66,534,229	Y789F	probably damaging	Het
Slit3	A	T	11: 35,688,682	S1229C	probably null	Het
Sptan1	T	C	2: 30,018,576		probably benign	Het
Srrd	G	T	5: 112,342,944		probably benign	Het
Tdrd3	A	G	14: 87,480,785	T201A	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Ttll4	A	G	1: 74,686,391	K653E	probably damaging	Het
Usp43	A	G	11: 67,879,969	L613P	probably damaging	Het
Vmn1r167	T	C	7: 23,504,799	D264G	possibly damaging	Het
Whamm	A	G	7: 81,571,341	D7G	probably damaging	Het
Zcchc17	T	C	4: 130,338,524	D62G	probably benign	Het
Zfp280d	T	A	9: 72,298,822	I62K	probably damaging	Het
Zfp445	T	G	9: 122,852,476	E800A	probably damaging	Het
Zfp516	A	G	18: 82,986,938	R656G	possibly damaging	Het

Other mutations in Hlx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Hlx	APN	1	184731595	missense	probably damaging	1.00
IGL01074:Hlx	APN	1	184727813	missense	probably damaging	1.00
IGL02543:Hlx	APN	1	184730751	missense	probably damaging	1.00
R0522:Hlx	UTSW	1	184731640	missense	probably damaging	1.00
R1104:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R1157:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R1158:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R1285:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R1286:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R1439:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R1489:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R1606:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R1974:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R1976:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R2161:Hlx	UTSW	1	184727641	missense	probably benign	0.12
R2340:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R2341:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R3237:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R3781:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R3782:Hlx	UTSW	1	184731987	missense	probably damaging	0.99
R5705:Hlx	UTSW	1	184730865	missense	probably benign	0.40
R5738:Hlx	UTSW	1	184731557	critical splice donor site	probably null
R6081:Hlx	UTSW	1	184727697	missense	probably benign
R7323:Hlx	UTSW	1	184730796	missense	probably benign	0.00
R7373:Hlx	UTSW	1	184730865	missense	probably benign	0.40
X0018:Hlx	UTSW	1	184727732	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- ACAAGTGTAACCCTCACCTTTG -3'
(R):5'- TCTCACATCGCTGCTAACCG -3'

Sequencing Primer
(F):5'- AGTGTAACCCTCACCTTTGAATAC -3'
(R):5'- ATCGCTGCTAACCGGTGGG -3'

Posted On

2014-10-01