Incidental Mutation 'R2162:Hlx'
ID236706
Institutional Source Beutler Lab
Gene Symbol Hlx
Ensembl Gene ENSMUSG00000039377
Gene NameH2.0-like homeobox
SynonymsHlx1
MMRRC Submission 040165-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2162 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location184727140-184732619 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 184730692 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048572] [ENSMUST00000174257]
Predicted Effect probably null
Transcript: ENSMUST00000048572
SMART Domains Protein: ENSMUSP00000040505
Gene: ENSMUSG00000039377

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
HOX 271 335 2.32e-22 SMART
low complexity region 353 379 N/A INTRINSIC
low complexity region 405 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174257
SMART Domains Protein: ENSMUSP00000134728
Gene: ENSMUSG00000039377

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 221 271 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for disrputions in this gene die as embryos as a result of defective organogenesis and fetal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,238 T524A possibly damaging Het
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Ankrd28 T C 14: 31,708,762 D850G probably damaging Het
Arhgap45 T C 10: 80,016,979 M1T probably null Het
Atp6v0a4 T G 6: 38,088,646 K128N possibly damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Clca4b T C 3: 144,928,587 I82V probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Eng C T 2: 32,679,047 R528C probably damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Htt T A 5: 34,821,718 V815D probably benign Het
Il1f5 G T 2: 24,279,680 L17F probably damaging Het
Itga1 C T 13: 115,030,910 V157I probably benign Het
Krtap19-3 T G 16: 88,877,719 *88C probably null Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Mroh7 G C 4: 106,700,181 S777R probably damaging Het
Nrxn1 G A 17: 90,162,431 R35C probably damaging Het
Olfr1145 T A 2: 87,810,360 I180K probably damaging Het
Olfr494 C A 7: 108,367,562 P24Q probably benign Het
Olfr624 T G 7: 103,670,872 Q53P possibly damaging Het
Pacs2 A G 12: 113,050,947 T243A probably benign Het
Pan2 A G 10: 128,304,222 E4G possibly damaging Het
Pdp1 A G 4: 11,961,123 V396A probably damaging Het
Pdzd7 A G 19: 45,036,055 probably null Het
Peg10 T A 6: 4,755,914 probably benign Het
Pgc C A 17: 47,729,311 F93L probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r9b T C 11: 94,998,051 L97P probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scn9a T A 2: 66,534,229 Y789F probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Sptan1 T C 2: 30,018,576 probably benign Het
Srrd G T 5: 112,342,944 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Usp43 A G 11: 67,879,969 L613P probably damaging Het
Vmn1r167 T C 7: 23,504,799 D264G possibly damaging Het
Whamm A G 7: 81,571,341 D7G probably damaging Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp280d T A 9: 72,298,822 I62K probably damaging Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zfp516 A G 18: 82,986,938 R656G possibly damaging Het
Other mutations in Hlx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Hlx APN 1 184731595 missense probably damaging 1.00
IGL01074:Hlx APN 1 184727813 missense probably damaging 1.00
IGL02543:Hlx APN 1 184730751 missense probably damaging 1.00
R0522:Hlx UTSW 1 184731640 missense probably damaging 1.00
R1104:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1157:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1158:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1285:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1286:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1439:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1489:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1606:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1974:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1976:Hlx UTSW 1 184731987 missense probably damaging 0.99
R2161:Hlx UTSW 1 184727641 missense probably benign 0.12
R2340:Hlx UTSW 1 184731987 missense probably damaging 0.99
R2341:Hlx UTSW 1 184731987 missense probably damaging 0.99
R3237:Hlx UTSW 1 184731987 missense probably damaging 0.99
R3781:Hlx UTSW 1 184731987 missense probably damaging 0.99
R3782:Hlx UTSW 1 184731987 missense probably damaging 0.99
R5705:Hlx UTSW 1 184730865 missense probably benign 0.40
R5738:Hlx UTSW 1 184731557 critical splice donor site probably null
R6081:Hlx UTSW 1 184727697 missense probably benign
R7323:Hlx UTSW 1 184730796 missense probably benign 0.00
R7373:Hlx UTSW 1 184730865 missense probably benign 0.40
X0018:Hlx UTSW 1 184727732 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACAAGTGTAACCCTCACCTTTG -3'
(R):5'- TCTCACATCGCTGCTAACCG -3'

Sequencing Primer
(F):5'- AGTGTAACCCTCACCTTTGAATAC -3'
(R):5'- ATCGCTGCTAACCGGTGGG -3'
Posted On2014-10-01