Incidental Mutation 'R2164:Ncapg2'
ID 236708
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Name non-SMC condensin II complex, subunit G2
Synonyms 5830426I05Rik, Mtb, mCAP-G2, Luzp5
MMRRC Submission 040167-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 116368969-116427152 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 116414095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
AlphaFold Q6DFV1
Predicted Effect probably null
Transcript: ENSMUST00000084828
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222761
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,101,019 (GRCm39) probably null Het
Adcy8 C T 15: 64,792,783 (GRCm39) G58S probably benign Het
Adgra2 T A 8: 27,604,232 (GRCm39) L24* probably null Het
Ampd2 C A 3: 107,992,685 (GRCm39) probably benign Het
Ankrd26 T G 6: 118,502,752 (GRCm39) E806A probably damaging Het
Apol9b A G 15: 77,619,639 (GRCm39) D145G probably benign Het
Ash1l T A 3: 88,892,726 (GRCm39) M1535K probably benign Het
Atf6 A G 1: 170,622,304 (GRCm39) M439T probably damaging Het
B3glct A T 5: 149,677,621 (GRCm39) M417L probably damaging Het
Cep192 A T 18: 67,953,431 (GRCm39) T483S probably damaging Het
Cep290 G A 10: 100,354,657 (GRCm39) E914K probably damaging Het
Chst15 C T 7: 131,872,114 (GRCm39) A56T probably damaging Het
Col27a1 A T 4: 63,143,661 (GRCm39) T450S probably benign Het
Cpsf2 A G 12: 101,951,594 (GRCm39) N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Ctc1 C T 11: 68,926,441 (GRCm39) A859V possibly damaging Het
Dcakd A G 11: 102,888,183 (GRCm39) Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 (GRCm39) Y22* probably null Het
Dync2h1 T A 9: 7,124,797 (GRCm39) D2025V probably damaging Het
Dync2li1 T C 17: 84,943,702 (GRCm39) S92P probably damaging Het
Eml5 A G 12: 98,853,356 (GRCm39) V81A probably damaging Het
Espl1 C T 15: 102,228,023 (GRCm39) R1625C probably damaging Het
Fam181a T C 12: 103,282,785 (GRCm39) V230A probably benign Het
Fanci T A 7: 79,045,743 (GRCm39) D28E probably benign Het
Fmn1 A G 2: 113,195,962 (GRCm39) N554S unknown Het
Frem2 T C 3: 53,444,751 (GRCm39) Y2460C probably damaging Het
Fscb G A 12: 64,520,567 (GRCm39) P300S probably damaging Het
Gm28042 A G 2: 119,867,229 (GRCm39) D438G probably benign Het
Ldaf1 A G 7: 119,719,462 (GRCm39) E157G possibly damaging Het
Map1b C T 13: 99,565,846 (GRCm39) V2292M unknown Het
Nbas A G 12: 13,380,647 (GRCm39) D635G possibly damaging Het
Nrp2 A T 1: 62,783,514 (GRCm39) E205V probably damaging Het
Pcdhb3 A T 18: 37,435,239 (GRCm39) T402S possibly damaging Het
Phc1 T C 6: 122,299,296 (GRCm39) N638D possibly damaging Het
Plcb1 A G 2: 135,188,250 (GRCm39) N781S possibly damaging Het
Prkdc T A 16: 15,523,071 (GRCm39) D1164E probably damaging Het
Proser2 T A 2: 6,105,506 (GRCm39) R353W possibly damaging Het
Prxl2b T G 4: 154,982,606 (GRCm39) Y56S probably damaging Het
Ptges T A 2: 30,782,708 (GRCm39) T115S probably benign Het
Ptprk A T 10: 28,436,138 (GRCm39) D833V probably damaging Het
Pum1 T A 4: 130,455,394 (GRCm39) L173* probably null Het
Pum1 G T 4: 130,455,395 (GRCm39) L269F probably damaging Het
Rasgrp4 A G 7: 28,838,470 (GRCm39) Y106C probably damaging Het
Rbbp6 T A 7: 122,598,697 (GRCm39) probably benign Het
Rdh1 A G 10: 127,596,041 (GRCm39) T79A possibly damaging Het
Relb A C 7: 19,347,686 (GRCm39) probably null Het
Rnf122 G A 8: 31,602,192 (GRCm39) W6* probably null Het
Rnf31 A G 14: 55,829,994 (GRCm39) E138G possibly damaging Het
Scaf8 G A 17: 3,247,485 (GRCm39) R936Q probably damaging Het
Scube3 T A 17: 28,385,108 (GRCm39) V686D possibly damaging Het
Snrnp27 A T 6: 86,653,196 (GRCm39) C141S probably benign Het
Spns2 C T 11: 72,349,497 (GRCm39) V252M possibly damaging Het
Tomm40l C T 1: 171,047,703 (GRCm39) S220N probably damaging Het
Trim17 A G 11: 58,862,237 (GRCm39) D423G probably damaging Het
Trpc6 A AT 9: 8,610,466 (GRCm39) probably null Het
Tut4 G A 4: 108,360,226 (GRCm39) R481Q possibly damaging Het
Uba5 A T 9: 103,937,442 (GRCm39) M89K probably damaging Het
Vav2 T C 2: 27,163,718 (GRCm39) D628G probably damaging Het
Vmn2r107 T C 17: 20,595,904 (GRCm39) L819P probably damaging Het
Vmn2r25 A T 6: 123,816,518 (GRCm39) D354E possibly damaging Het
Xrn1 A G 9: 95,888,873 (GRCm39) E984G possibly damaging Het
Zbtb17 T C 4: 141,191,557 (GRCm39) V223A probably benign Het
Zfp592 T C 7: 80,691,186 (GRCm39) S1122P possibly damaging Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116,388,270 (GRCm39) missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116,370,850 (GRCm39) utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116,390,331 (GRCm39) missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116,389,438 (GRCm39) missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116,407,952 (GRCm39) missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116,424,203 (GRCm39) missense probably benign
IGL02409:Ncapg2 APN 12 116,384,337 (GRCm39) missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116,384,309 (GRCm39) missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116,389,526 (GRCm39) critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116,415,894 (GRCm39) missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116,415,993 (GRCm39) splice site probably benign
IGL03199:Ncapg2 APN 12 116,382,856 (GRCm39) missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116,403,677 (GRCm39) missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116,402,255 (GRCm39) missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116,393,455 (GRCm39) missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116,384,303 (GRCm39) splice site probably null
R0379:Ncapg2 UTSW 12 116,406,695 (GRCm39) missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116,386,835 (GRCm39) missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116,376,779 (GRCm39) nonsense probably null
R1016:Ncapg2 UTSW 12 116,402,295 (GRCm39) missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116,424,186 (GRCm39) missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116,398,198 (GRCm39) splice site probably benign
R1596:Ncapg2 UTSW 12 116,382,856 (GRCm39) missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116,398,305 (GRCm39) frame shift probably null
R1752:Ncapg2 UTSW 12 116,390,338 (GRCm39) missense probably damaging 1.00
R2266:Ncapg2 UTSW 12 116,393,296 (GRCm39) missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116,384,349 (GRCm39) nonsense probably null
R2924:Ncapg2 UTSW 12 116,402,349 (GRCm39) missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116,402,349 (GRCm39) missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116,370,938 (GRCm39) splice site probably benign
R3829:Ncapg2 UTSW 12 116,370,938 (GRCm39) splice site probably benign
R4384:Ncapg2 UTSW 12 116,403,497 (GRCm39) critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116,389,407 (GRCm39) missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116,404,238 (GRCm39) missense probably benign
R4821:Ncapg2 UTSW 12 116,379,077 (GRCm39) missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116,404,208 (GRCm39) missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116,391,406 (GRCm39) missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116,391,414 (GRCm39) missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116,390,257 (GRCm39) missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116,376,697 (GRCm39) missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116,389,420 (GRCm39) missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116,393,277 (GRCm39) missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116,388,291 (GRCm39) missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116,390,227 (GRCm39) missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116,406,641 (GRCm39) missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116,401,631 (GRCm39) missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116,391,376 (GRCm39) missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116,398,281 (GRCm39) missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116,390,202 (GRCm39) missense probably benign
R7069:Ncapg2 UTSW 12 116,388,337 (GRCm39) splice site probably null
R7339:Ncapg2 UTSW 12 116,378,454 (GRCm39) missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116,414,033 (GRCm39) missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116,382,888 (GRCm39) missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116,382,897 (GRCm39) missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116,390,197 (GRCm39) missense probably benign
R8132:Ncapg2 UTSW 12 116,407,967 (GRCm39) missense possibly damaging 0.93
R8166:Ncapg2 UTSW 12 116,376,036 (GRCm39) missense probably benign 0.00
R8351:Ncapg2 UTSW 12 116,403,647 (GRCm39) missense possibly damaging 0.80
R8526:Ncapg2 UTSW 12 116,403,679 (GRCm39) missense probably benign 0.00
R8692:Ncapg2 UTSW 12 116,414,049 (GRCm39) missense probably damaging 1.00
R8739:Ncapg2 UTSW 12 116,379,098 (GRCm39) missense possibly damaging 0.75
R8766:Ncapg2 UTSW 12 116,390,356 (GRCm39) missense probably damaging 1.00
R8929:Ncapg2 UTSW 12 116,415,983 (GRCm39) missense probably damaging 1.00
R9046:Ncapg2 UTSW 12 116,376,145 (GRCm39) missense probably benign 0.01
R9187:Ncapg2 UTSW 12 116,402,287 (GRCm39) missense probably damaging 1.00
R9344:Ncapg2 UTSW 12 116,388,273 (GRCm39) missense probably damaging 1.00
R9444:Ncapg2 UTSW 12 116,370,863 (GRCm39) missense probably damaging 1.00
R9580:Ncapg2 UTSW 12 116,424,228 (GRCm39) missense probably damaging 1.00
R9634:Ncapg2 UTSW 12 116,379,077 (GRCm39) missense probably damaging 0.99
R9749:Ncapg2 UTSW 12 116,411,368 (GRCm39) nonsense probably null
X0020:Ncapg2 UTSW 12 116,388,327 (GRCm39) missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116,402,225 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTCCCATGTTACCTGAAAAGTG -3'
(R):5'- AAGGCCCATGGACCATACTG -3'

Sequencing Primer
(F):5'- ATTATGGGTGAACCTTGTCCATG -3'
(R):5'- CATACTGCATTTAGACAGCACTAGGG -3'
Posted On 2014-10-01