Mutagenetix > Incidental Mutation

Incidental Mutation 'R0973:Stat4'

236711

Institutional Source

Beutler Lab

Gene Symbol

Stat4

Ensembl Gene

ENSMUSG00000062939

Gene Name

signal transducer and activator of transcription 4

Synonyms

MMRRC Submission

039102-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.526) question?

Stock #

R0973 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51987148-52107189 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52096820 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 429 (I429M)

Ref Sequence

ENSEMBL: ENSMUSP00000130713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000027277
AA Change: I429M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: I429M

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	140	314	2.2e-54	PFAM
Pfam:STAT_bind	316	562	4.7e-76	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168302
AA Change: I429M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: I429M

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	137	314	8.2e-66	PFAM
Pfam:STAT_bind	316	563	3.3e-114	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185516

Meta Mutation Damage Score

0.5247

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

93% (38/41)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	C	T	1: 184,033,505	S119N	probably benign	Het
4930503L19Rik	T	A	18: 70,467,926		probably null	Het
5430419D17Rik	T	C	7: 131,238,182	L611P	probably damaging	Het
Adam18	T	C	8: 24,647,853	T324A	probably benign	Het
Adamts20	T	A	15: 94,286,371	Q1517L	probably benign	Het
AI429214	A	G	8: 36,994,319	Q207R	probably benign	Het
Arhgef7	A	G	8: 11,819,659	T432A	possibly damaging	Het
Atad2b	A	G	12: 5,031,784	N1231S	probably benign	Het
Atp13a1	T	C	8: 69,802,144		probably null	Het
Atp6v0a1	T	A	11: 101,055,491	L770*	probably null	Het
Atp8b3	T	C	10: 80,534,198	N127S	probably damaging	Het
B3gnt5	T	A	16: 19,770,010	D326E	probably damaging	Het
Birc6	T	A	17: 74,565,861	S372T	probably damaging	Het
Btbd9	T	A	17: 30,299,633	D451V	probably damaging	Het
Cd46	T	C	1: 195,041,992	*366W	probably null	Het
Cdh18	T	A	15: 23,473,995	D650E	probably damaging	Het
Cenpc1	A	T	5: 86,037,908	V248E	probably damaging	Het
Cep152	A	G	2: 125,594,899	S574P	probably benign	Het
Chd2	A	G	7: 73,478,664	S858P	probably damaging	Het
Cib4	T	C	5: 30,488,594	D110G	probably damaging	Het
Col9a2	T	A	4: 121,039,788		probably null	Het
Csmd2	A	T	4: 128,496,188	I2239F	possibly damaging	Het
Csmd3	C	A	15: 47,659,089	G2728V	probably damaging	Het
Cxcl1	A	T	5: 90,891,767	K85*	probably null	Het
Cyp2d11	A	G	15: 82,389,529	L416P	possibly damaging	Het
Daam1	A	C	12: 71,915,784	K90T	unknown	Het
Depdc5	T	A	5: 32,986,966	M1435K	possibly damaging	Het
Diexf	A	T	1: 193,114,703	N573K	probably damaging	Het
Dip2c	G	A	13: 9,576,908	A632T	probably damaging	Het
Dld	A	T	12: 31,334,054	I350N	probably damaging	Het
Dmtf1	T	A	5: 9,127,987	I391F	possibly damaging	Het
Dnah14	T	C	1: 181,752,145	V3081A	probably damaging	Het
Efemp1	A	G	11: 28,854,538	E22G	probably damaging	Het
Ephb6	A	G	6: 41,614,104	D65G	probably damaging	Het
Fsip2	A	T	2: 82,977,092	T1252S	probably benign	Het
Gm13084	T	C	4: 143,811,858	Y181C	probably damaging	Het
Gm4847	A	G	1: 166,630,255	S510P	probably benign	Het
Golga4	T	C	9: 118,537,273	I365T	probably damaging	Het
Gp2	A	T	7: 119,454,543	L65Q	probably damaging	Het
Ibtk	T	C	9: 85,743,577	Y40C	probably damaging	Het
Ice1	C	A	13: 70,602,427	V1847L	probably benign	Het
Ift172	C	T	5: 31,265,355	R917H	probably benign	Het
Itgae	C	T	11: 73,138,509	Q1037*	probably null	Het
Kbtbd7	A	G	14: 79,427,430	E234G	possibly damaging	Het
Khsrp	T	C	17: 57,025,576	T235A	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Lrfn5	G	A	12: 61,843,437	G504D	probably damaging	Het
Macf1	A	G	4: 123,476,000	V91A	possibly damaging	Het
Map6	G	A	7: 99,336,743	G821D	possibly damaging	Het
Mark1	A	C	1: 184,921,604	V167G	probably damaging	Het
Mrgprf	T	A	7: 145,308,256	L185Q	probably damaging	Het
Mtor	T	A	4: 148,550,188	V2422D	probably damaging	Het
Myh13	T	A	11: 67,332,520	I222N	probably damaging	Het
Myh7b	G	A	2: 155,620,427	C350Y	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfm3	C	A	3: 115,101,986	S172R	probably benign	Het
Olfr1168	A	T	2: 88,184,978	T34S	probably benign	Het
Olfr1231	A	T	2: 89,303,184	I136N	probably damaging	Het
Olfr342	A	G	2: 36,528,008	I199V	probably benign	Het
Olfr70	A	G	4: 43,696,706	S156P	probably damaging	Het
Olfr912	T	A	9: 38,581,283	V2D	possibly damaging	Het
Pacs1	A	T	19: 5,143,829	D557E	probably damaging	Het
Pde1c	A	G	6: 56,361,815	F11L	probably benign	Het
Phactr2	T	C	10: 13,247,139	D343G	possibly damaging	Het
Piezo2	T	C	18: 63,015,802	Y2659C	probably damaging	Het
Pkd2l2	A	G	18: 34,428,252	T438A	probably damaging	Het
Pld2	T	C	11: 70,557,081	W857R	probably damaging	Het
Plxnb1	T	C	9: 109,102,142	V410A	possibly damaging	Het
Ptger2	A	G	14: 44,989,500	Y179C	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rcan1	A	T	16: 92,393,520	M177K	probably benign	Het
Rilpl1	A	G	5: 124,501,871	S156P	probably benign	Het
Rilpl1	A	G	5: 124,501,888	I122T	possibly damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Rpa1	C	T	11: 75,312,973		probably null	Het
Saxo2	A	G	7: 82,634,870	V260A	probably benign	Het
Sel1l	T	C	12: 91,824,860	Y309C	probably damaging	Het
Setd1b	GCCCCCCC	GCCCCCCCCCCCCC	5: 123,160,703		probably benign	Het
Slc33a1	A	G	3: 63,943,304	F533S	probably benign	Het
Slc38a4	C	T	15: 97,005,858	V421M	probably benign	Het
Snx14	A	G	9: 88,400,721		probably null	Het
Spef2	A	G	15: 9,716,396	F368S	probably damaging	Het
Sri	A	T	5: 8,059,381	Q55L	probably damaging	Het
Stkld1	A	T	2: 26,951,450	Q469L	probably benign	Het
Tm9sf1	T	C	14: 55,642,935	T2A	possibly damaging	Het
Tmco5	A	G	2: 116,883,218	T122A	probably benign	Het
Tmem59l	G	A	8: 70,486,060	P124S	possibly damaging	Het
Tmem81	G	A	1: 132,507,924	R156Q	probably damaging	Het
Trpv6	T	A	6: 41,625,188	T396S	probably benign	Het
Usp24	T	A	4: 106,371,079	Y780*	probably null	Het
Vmn1r120	A	G	7: 21,053,016	C257R	probably damaging	Het
Vmn2r53	A	G	7: 12,601,392	F114L	probably damaging	Het
Vwf	A	G	6: 125,643,006	E1549G	probably damaging	Het
Zfp626	G	A	7: 27,818,482	R296H	probably damaging	Het

Other mutations in Stat4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Stat4	APN	1	52102878	missense	probably damaging	1.00
IGL00482:Stat4	APN	1	52074697	missense	probably benign	0.05
IGL01395:Stat4	APN	1	52011874	missense	probably damaging	1.00
IGL01533:Stat4	APN	1	52098419	missense	probably damaging	1.00
IGL01943:Stat4	APN	1	52096855	missense	possibly damaging	0.94
IGL02114:Stat4	APN	1	52102865	missense	probably damaging	1.00
IGL02151:Stat4	APN	1	52013870	missense	probably damaging	0.99
IGL02601:Stat4	APN	1	52098415	missense	probably damaging	1.00
R0016:Stat4	UTSW	1	52068780	missense	probably benign	0.01
R0243:Stat4	UTSW	1	52011857	missense	probably benign	0.22
R0329:Stat4	UTSW	1	52090870	intron	probably benign
R1144:Stat4	UTSW	1	52084129	splice site	probably benign
R1187:Stat4	UTSW	1	52076677	missense	probably damaging	1.00
R1331:Stat4	UTSW	1	52013927	missense	probably benign	0.20
R1401:Stat4	UTSW	1	52071947	splice site	probably benign
R1529:Stat4	UTSW	1	52011793	missense	probably damaging	1.00
R1711:Stat4	UTSW	1	52106925	missense	probably damaging	1.00
R2213:Stat4	UTSW	1	52013855	missense	probably damaging	0.98
R3003:Stat4	UTSW	1	52102986	missense	probably damaging	1.00
R3683:Stat4	UTSW	1	52013822	missense	possibly damaging	0.89
R3789:Stat4	UTSW	1	52011796	missense	probably benign	0.07
R3919:Stat4	UTSW	1	52096822	missense	possibly damaging	0.62
R4320:Stat4	UTSW	1	52074707	missense	probably benign
R4373:Stat4	UTSW	1	52071941	critical splice donor site	probably null
R5024:Stat4	UTSW	1	52082570	missense	possibly damaging	0.80
R5103:Stat4	UTSW	1	52071895	missense	probably damaging	0.97
R5206:Stat4	UTSW	1	52105236	missense	probably damaging	0.99
R5944:Stat4	UTSW	1	52074739	missense	probably damaging	1.00
R5961:Stat4	UTSW	1	52065384	missense	possibly damaging	0.50
R6001:Stat4	UTSW	1	52096867	missense	probably damaging	0.96
R6161:Stat4	UTSW	1	52074677	missense	possibly damaging	0.94
R6262:Stat4	UTSW	1	52102201	missense	probably null	1.00
R6701:Stat4	UTSW	1	52102974	missense	probably damaging	1.00
R6767:Stat4	UTSW	1	52076583	missense	probably benign	0.00
R6989:Stat4	UTSW	1	52068815	missense	probably benign	0.09
R7507:Stat4	UTSW	1	52078574	missense	probably damaging	1.00
R7539:Stat4	UTSW	1	52071709	splice site	probably null
R7546:Stat4	UTSW	1	52098463	missense	probably damaging	0.98
R7616:Stat4	UTSW	1	52013878	nonsense	probably null
R7751:Stat4	UTSW	1	52082552	missense	possibly damaging	0.73
R8052:Stat4	UTSW	1	52079773	missense	probably damaging	1.00
R8311:Stat4	UTSW	1	52102916	missense	probably damaging	1.00
R8419:Stat4	UTSW	1	52098478	missense	possibly damaging	0.89
R8679:Stat4	UTSW	1	52079832	missense	probably null	1.00
R8699:Stat4	UTSW	1	52071937	missense	probably benign
R8738:Stat4	UTSW	1	52076552	missense	possibly damaging	0.95
R8921:Stat4	UTSW	1	52105733	missense	probably benign	0.39
R9013:Stat4	UTSW	1	52011798	missense	probably benign	0.00
R9237:Stat4	UTSW	1	52106914	missense	probably benign
R9729:Stat4	UTSW	1	52102603	missense	possibly damaging	0.94
R9767:Stat4	UTSW	1	52102494	missense	probably damaging	1.00
Z1177:Stat4	UTSW	1	52084099	nonsense	probably null
Z1177:Stat4	UTSW	1	52098485	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAGAACTCATGTTTTGGAAACTG -3'
(R):5'- TGTTGAATTCACAAGAGTCATGGAGTC -3'

Sequencing Primer
(F):5'- GGAAACTGAAAGTCATTCTTTGCC -3'
(R):5'- CACAAGAGTCATGGAGTCTTTATC -3'

Posted On

2014-10-02