Incidental Mutation 'R0973:Macf1'
ID 236719
Institutional Source Beutler Lab
Gene Symbol Macf1
Ensembl Gene ENSMUSG00000028649
Gene Name microtubule-actin crosslinking factor 1
Synonyms trabeculin alpha, Aclp7, Acf7
MMRRC Submission 039102-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0973 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 123243426-123581331 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123369793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000101819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082108] [ENSMUST00000084301] [ENSMUST00000097897] [ENSMUST00000106213] [ENSMUST00000106220] [ENSMUST00000106224] [ENSMUST00000134458] [ENSMUST00000147030] [ENSMUST00000147228] [ENSMUST00000151346]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082108
SMART Domains Protein: ENSMUSP00000080755
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
SPEC 1550 1658 3.94e-3 SMART
SPEC 1818 1928 4.03e-9 SMART
SPEC 1935 2041 1.75e-9 SMART
SPEC 2048 2150 5.57e-3 SMART
SPEC 2157 2256 4.56e0 SMART
SPEC 2263 2394 3.46e-1 SMART
SPEC 2401 2506 1.29e-7 SMART
SPEC 2513 2617 1.19e-2 SMART
SPEC 2624 2727 2.7e-1 SMART
SPEC 2734 2837 4.99e-14 SMART
SPEC 2844 2944 1.9e-5 SMART
SPEC 2951 3057 2.83e0 SMART
SPEC 3060 3162 2.14e-4 SMART
SPEC 3169 3273 3.01e-8 SMART
SPEC 3280 3382 4.48e-16 SMART
SPEC 3389 3491 1.26e-10 SMART
SPEC 3498 3600 2.26e-3 SMART
SPEC 3607 3709 4.29e-4 SMART
SPEC 3716 3817 9.99e-14 SMART
SPEC 3824 3930 5.79e-2 SMART
SPEC 3937 4039 6.59e-14 SMART
SPEC 4046 4149 3.7e-17 SMART
SPEC 4156 4258 1.16e-23 SMART
SPEC 4265 4368 3.58e-15 SMART
SPEC 4375 4477 2.61e-17 SMART
SPEC 4484 4587 9.38e-19 SMART
SPEC 4594 4695 2.29e-22 SMART
SPEC 4702 4804 4.99e-14 SMART
SPEC 4811 4941 1.45e-10 SMART
EFh 4979 5007 5.08e-3 SMART
EFh 5015 5043 1.17e-2 SMART
GAS2 5054 5132 8.5e-54 SMART
low complexity region 5154 5199 N/A INTRINSIC
low complexity region 5248 5273 N/A INTRINSIC
low complexity region 5290 5302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084301
AA Change: V1656A

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081324
Gene: ENSMUSG00000028649
AA Change: V1656A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 2.8e-30 SMART
CH 196 293 3.6e-26 SMART
SPEC 317 420 2.6e-2 SMART
SPEC 583 680 2.7e-11 SMART
SPEC 683 783 3.6e-7 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 1.5e-2 SMART
SPEC 1425 1533 6.9e-10 SMART
PLEC 1530 1576 5.3e-6 SMART
PLEC 1577 1614 1.2e-2 SMART
PLEC 1616 1653 8.7e-2 SMART
PLEC 1654 1691 8.3e-2 SMART
PLEC 1695 1729 1.3e-1 SMART
PLEC 1731 1767 1.4e-4 SMART
PLEC 1768 1805 2e-12 SMART
PLEC 1808 1843 5.2e-4 SMART
PLEC 1844 1881 4e-2 SMART
PLEC 1884 1919 1.9e0 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 4.5e-6 SMART
PLEC 2347 2388 1.7e-7 SMART
PLEC 2389 2426 1.2e-5 SMART
PLEC 2447 2484 6.3e-3 SMART
PLEC 2485 2522 2.1e-4 SMART
PLEC 2523 2561 1.5e-1 SMART
PLEC 2586 2633 3.1e-1 SMART
PLEC 2671 2708 6.5e-10 SMART
PLEC 2709 2746 2.3e-3 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3683 7.1e-3 SMART
SPEC 3841 3951 2.6e-11 SMART
SPEC 3958 4064 1.1e-11 SMART
SPEC 4071 4173 3.6e-5 SMART
SPEC 4180 4279 2.9e-2 SMART
SPEC 4286 4417 2.2e-3 SMART
SPEC 4424 4529 8.2e-10 SMART
SPEC 4536 4640 7.4e-5 SMART
SPEC 4647 4750 1.7e-3 SMART
SPEC 4757 4860 3.2e-16 SMART
SPEC 4867 4967 1.2e-7 SMART
SPEC 4974 5080 1.8e-2 SMART
SPEC 5083 5185 1.3e-6 SMART
SPEC 5192 5296 2e-10 SMART
SPEC 5303 5405 2.8e-18 SMART
SPEC 5412 5514 7.7e-13 SMART
SPEC 5521 5623 1.5e-5 SMART
SPEC 5630 5732 2.7e-6 SMART
SPEC 5739 5840 6.1e-16 SMART
SPEC 5847 5953 3.6e-4 SMART
SPEC 5960 6062 4.1e-16 SMART
SPEC 6069 6172 2.4e-19 SMART
SPEC 6179 6281 7.6e-26 SMART
SPEC 6288 6391 2.2e-17 SMART
SPEC 6398 6500 1.6e-19 SMART
SPEC 6507 6610 5.7e-21 SMART
SPEC 6617 6718 1.5e-24 SMART
SPEC 6725 6827 3.2e-16 SMART
SPEC 6834 6964 9.4e-13 SMART
EFh 7002 7030 2.4e-5 SMART
EFh 7038 7066 5.8e-5 SMART
GAS2 7077 7155 5.5e-56 SMART
low complexity region 7177 7222 N/A INTRINSIC
low complexity region 7271 7296 N/A INTRINSIC
low complexity region 7313 7325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097897
AA Change: V1656A

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095507
Gene: ENSMUSG00000028649
AA Change: V1656A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4644 1.19e-2 SMART
SPEC 4651 4754 2.7e-1 SMART
SPEC 4761 4864 4.99e-14 SMART
SPEC 4871 4971 1.9e-5 SMART
SPEC 4978 5084 2.83e0 SMART
SPEC 5087 5189 2.14e-4 SMART
SPEC 5196 5300 3.01e-8 SMART
SPEC 5307 5409 4.48e-16 SMART
SPEC 5416 5518 1.26e-10 SMART
SPEC 5525 5627 2.26e-3 SMART
SPEC 5634 5736 4.29e-4 SMART
SPEC 5743 5844 9.99e-14 SMART
SPEC 5851 5957 5.79e-2 SMART
SPEC 5964 6066 6.59e-14 SMART
SPEC 6073 6176 3.7e-17 SMART
SPEC 6183 6285 1.16e-23 SMART
SPEC 6292 6395 3.58e-15 SMART
SPEC 6402 6504 2.61e-17 SMART
SPEC 6511 6614 9.38e-19 SMART
SPEC 6621 6722 2.29e-22 SMART
SPEC 6729 6831 4.99e-14 SMART
SPEC 6838 6968 1.45e-10 SMART
EFh 7006 7034 5.08e-3 SMART
EFh 7042 7070 1.17e-2 SMART
GAS2 7081 7159 8.5e-54 SMART
low complexity region 7181 7226 N/A INTRINSIC
low complexity region 7275 7300 N/A INTRINSIC
low complexity region 7317 7329 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106213
AA Change: V91A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101819
Gene: ENSMUSG00000028649
AA Change: V91A

DomainStartEndE-ValueType
PLEC 12 49 1.9e0 SMART
PLEC 51 88 1.38e1 SMART
PLEC 89 126 1.3e1 SMART
PLEC 130 164 2.1e1 SMART
PLEC 166 202 2.23e-2 SMART
PLEC 203 240 3.32e-10 SMART
PLEC 243 278 8.32e-2 SMART
PLEC 279 316 6.42e0 SMART
PLEC 319 354 3e2 SMART
low complexity region 421 432 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
PLEC 710 747 6.97e-4 SMART
PLEC 782 823 2.68e-5 SMART
PLEC 824 861 1.84e-3 SMART
PLEC 882 919 1.01e0 SMART
PLEC 920 957 3.38e-2 SMART
PLEC 958 996 2.39e1 SMART
PLEC 1021 1068 4.99e1 SMART
PLEC 1106 1143 1.05e-7 SMART
PLEC 1144 1181 3.57e-1 SMART
low complexity region 1375 1385 N/A INTRINSIC
coiled coil region 1790 1823 N/A INTRINSIC
low complexity region 1854 1864 N/A INTRINSIC
low complexity region 1990 2011 N/A INTRINSIC
SPEC 2012 2120 3.94e-3 SMART
SPEC 2280 2390 4.03e-9 SMART
SPEC 2397 2503 1.75e-9 SMART
SPEC 2510 2612 5.57e-3 SMART
SPEC 2619 2718 4.56e0 SMART
SPEC 2725 2856 3.46e-1 SMART
SPEC 2863 2968 1.29e-7 SMART
SPEC 2975 3079 1.19e-2 SMART
SPEC 3086 3189 2.7e-1 SMART
SPEC 3196 3299 4.99e-14 SMART
SPEC 3306 3406 1.9e-5 SMART
SPEC 3413 3519 2.83e0 SMART
SPEC 3522 3624 2.14e-4 SMART
SPEC 3631 3735 3.01e-8 SMART
SPEC 3742 3844 4.48e-16 SMART
SPEC 3851 3953 4.15e-11 SMART
SPEC 3960 4062 7.07e-5 SMART
SPEC 4069 4171 2.26e-3 SMART
SPEC 4178 4280 4.29e-4 SMART
SPEC 4287 4388 9.99e-14 SMART
SPEC 4395 4501 5.79e-2 SMART
SPEC 4508 4610 6.59e-14 SMART
SPEC 4617 4720 3.7e-17 SMART
SPEC 4727 4829 1.16e-23 SMART
SPEC 4836 4939 3.58e-15 SMART
SPEC 4946 5048 2.61e-17 SMART
SPEC 5055 5158 9.38e-19 SMART
SPEC 5165 5266 2.29e-22 SMART
SPEC 5273 5375 4.99e-14 SMART
SPEC 5382 5512 1.45e-10 SMART
EFh 5546 5574 5.08e-3 SMART
EFh 5582 5610 1.17e-2 SMART
GAS2 5621 5699 8.5e-54 SMART
low complexity region 5721 5766 N/A INTRINSIC
low complexity region 5815 5840 N/A INTRINSIC
low complexity region 5857 5869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106220
SMART Domains Protein: ENSMUSP00000101827
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
CH 347 444 7.49e-24 SMART
SPEC 468 571 4.11e0 SMART
SPEC 734 831 4.32e-9 SMART
SPEC 834 934 5.75e-5 SMART
Blast:SPEC 941 1106 5e-82 BLAST
coiled coil region 1197 1218 N/A INTRINSIC
SPEC 1429 1558 2.35e0 SMART
SPEC 1576 1684 1.12e-7 SMART
SPEC 1701 1809 1.85e-1 SMART
SPEC 1968 2078 4.03e-9 SMART
SPEC 2085 2191 1.75e-9 SMART
SPEC 2198 2300 5.57e-3 SMART
SPEC 2307 2406 4.56e0 SMART
SPEC 2413 2544 3.46e-1 SMART
SPEC 2551 2656 1.29e-7 SMART
SPEC 2663 2767 1.19e-2 SMART
SPEC 2774 2877 2.7e-1 SMART
SPEC 2884 2987 4.99e-14 SMART
SPEC 2994 3094 1.9e-5 SMART
SPEC 3101 3207 2.83e0 SMART
SPEC 3210 3312 2.14e-4 SMART
SPEC 3319 3423 3.01e-8 SMART
SPEC 3430 3532 4.48e-16 SMART
SPEC 3539 3641 1.26e-10 SMART
SPEC 3648 3750 2.26e-3 SMART
SPEC 3757 3859 4.29e-4 SMART
SPEC 3866 3967 9.99e-14 SMART
SPEC 3974 4080 5.79e-2 SMART
SPEC 4087 4189 6.59e-14 SMART
SPEC 4196 4299 3.7e-17 SMART
SPEC 4306 4408 1.16e-23 SMART
SPEC 4415 4518 3.58e-15 SMART
SPEC 4525 4627 2.61e-17 SMART
SPEC 4634 4737 9.38e-19 SMART
SPEC 4744 4845 2.29e-22 SMART
SPEC 4852 4954 4.99e-14 SMART
SPEC 4961 5091 1.45e-10 SMART
EFh 5129 5157 5.08e-3 SMART
EFh 5165 5193 1.17e-2 SMART
GAS2 5204 5282 1.59e-53 SMART
low complexity region 5304 5349 N/A INTRINSIC
low complexity region 5398 5423 N/A INTRINSIC
low complexity region 5440 5452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106224
AA Change: V1656A

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101831
Gene: ENSMUSG00000028649
AA Change: V1656A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4642 9.34e-2 SMART
SPEC 4649 4752 2.7e-1 SMART
SPEC 4759 4862 4.99e-14 SMART
SPEC 4869 4969 1.9e-5 SMART
SPEC 4976 5082 2.83e0 SMART
SPEC 5085 5187 2.14e-4 SMART
SPEC 5194 5298 3.01e-8 SMART
SPEC 5305 5407 4.48e-16 SMART
SPEC 5414 5516 1.26e-10 SMART
SPEC 5523 5625 2.26e-3 SMART
SPEC 5632 5734 4.29e-4 SMART
SPEC 5741 5842 9.99e-14 SMART
SPEC 5849 5955 5.79e-2 SMART
SPEC 5962 6064 6.59e-14 SMART
SPEC 6071 6174 3.7e-17 SMART
SPEC 6181 6283 1.16e-23 SMART
SPEC 6290 6393 3.58e-15 SMART
SPEC 6400 6502 2.61e-17 SMART
SPEC 6509 6612 9.38e-19 SMART
SPEC 6619 6720 2.29e-22 SMART
SPEC 6727 6829 4.99e-14 SMART
SPEC 6836 6966 1.45e-10 SMART
EFh 7004 7032 5.08e-3 SMART
EFh 7040 7068 1.17e-2 SMART
GAS2 7079 7157 8.5e-54 SMART
low complexity region 7179 7224 N/A INTRINSIC
low complexity region 7273 7298 N/A INTRINSIC
low complexity region 7315 7327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134458
SMART Domains Protein: ENSMUSP00000119885
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
PDB:3R6N|B 3 168 5e-37 PDB
coiled coil region 178 199 N/A INTRINSIC
SPEC 410 539 2.35e0 SMART
SPEC 557 665 1.12e-7 SMART
SPEC 682 790 3.94e-3 SMART
SPEC 950 1060 4.03e-9 SMART
SPEC 1067 1173 1.75e-9 SMART
SPEC 1180 1282 5.57e-3 SMART
SPEC 1289 1388 4.56e0 SMART
SPEC 1395 1505 3.18e-1 SMART
SPEC 1512 1617 1.29e-7 SMART
SPEC 1624 1728 1.19e-2 SMART
SPEC 1735 1838 2.7e-1 SMART
SPEC 1845 1948 4.99e-14 SMART
SPEC 1955 2055 1.9e-5 SMART
SPEC 2062 2168 2.83e0 SMART
SPEC 2171 2273 2.14e-4 SMART
SPEC 2280 2384 3.01e-8 SMART
SPEC 2391 2493 4.48e-16 SMART
SPEC 2500 2602 1.26e-10 SMART
SPEC 2609 2711 2.26e-3 SMART
SPEC 2718 2820 4.29e-4 SMART
SPEC 2827 2928 9.99e-14 SMART
SPEC 2935 3041 5.79e-2 SMART
SPEC 3048 3150 6.59e-14 SMART
SPEC 3157 3260 3.7e-17 SMART
SPEC 3267 3369 1.16e-23 SMART
SPEC 3376 3479 3.58e-15 SMART
SPEC 3486 3588 2.61e-17 SMART
SPEC 3595 3698 9.38e-19 SMART
SPEC 3705 3806 2.29e-22 SMART
SPEC 3813 3915 4.99e-14 SMART
SPEC 3922 4052 1.45e-10 SMART
EFh 4086 4114 5.08e-3 SMART
EFh 4122 4150 1.17e-2 SMART
GAS2 4161 4233 2.28e-54 SMART
low complexity region 4255 4300 N/A INTRINSIC
low complexity region 4349 4374 N/A INTRINSIC
low complexity region 4391 4403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147030
SMART Domains Protein: ENSMUSP00000123246
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
CH 38 137 5.63e-28 SMART
CH 154 251 7.49e-24 SMART
SPEC 275 378 4.11e0 SMART
SPEC 541 638 4.32e-9 SMART
SPEC 641 741 5.75e-5 SMART
Blast:SPEC 748 913 2e-82 BLAST
coiled coil region 1004 1025 N/A INTRINSIC
SPEC 1236 1365 2.35e0 SMART
SPEC 1383 1491 1.12e-7 SMART
SPEC 1508 1616 3.94e-3 SMART
Pfam:Spectrin 1773 1837 9.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147228
SMART Domains Protein: ENSMUSP00000115847
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
CH 347 444 7.49e-24 SMART
SPEC 468 571 4.11e0 SMART
SPEC 734 831 4.32e-9 SMART
SPEC 834 934 5.75e-5 SMART
Blast:SPEC 941 1106 4e-82 BLAST
coiled coil region 1197 1218 N/A INTRINSIC
SPEC 1429 1558 2.35e0 SMART
SPEC 1576 1684 1.12e-7 SMART
SPEC 1701 1809 3.94e-3 SMART
Pfam:Spectrin 1966 2030 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151346
SMART Domains Protein: ENSMUSP00000114568
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
CH 4 85 4.88e-14 SMART
CH 102 199 7.49e-24 SMART
SPEC 223 326 4.11e0 SMART
SPEC 489 586 4.32e-9 SMART
SPEC 589 689 5.75e-5 SMART
Blast:SPEC 696 861 3e-82 BLAST
coiled coil region 952 973 N/A INTRINSIC
SPEC 1184 1313 2.35e0 SMART
SPEC 1331 1439 1.12e-7 SMART
SPEC 1456 1564 3.94e-3 SMART
SPEC 1724 1834 4.03e-9 SMART
SPEC 1841 1947 1.75e-9 SMART
SPEC 1954 2056 5.57e-3 SMART
SPEC 2063 2162 4.56e0 SMART
SPEC 2169 2300 3.46e-1 SMART
SPEC 2307 2412 1.29e-7 SMART
SPEC 2419 2523 1.19e-2 SMART
SPEC 2530 2633 2.7e-1 SMART
SPEC 2640 2743 4.99e-14 SMART
SPEC 2750 2850 1.9e-5 SMART
SPEC 2857 2963 2.83e0 SMART
SPEC 2966 3068 2.14e-4 SMART
SPEC 3075 3179 3.01e-8 SMART
SPEC 3186 3288 4.48e-16 SMART
SPEC 3295 3397 4.15e-11 SMART
SPEC 3404 3506 7.07e-5 SMART
SPEC 3513 3615 2.26e-3 SMART
SPEC 3622 3724 4.29e-4 SMART
SPEC 3731 3832 9.99e-14 SMART
SPEC 3839 3945 5.79e-2 SMART
SPEC 3952 4054 6.59e-14 SMART
SPEC 4061 4164 3.7e-17 SMART
SPEC 4171 4273 1.16e-23 SMART
SPEC 4280 4383 3.58e-15 SMART
SPEC 4390 4492 2.61e-17 SMART
SPEC 4499 4602 9.38e-19 SMART
SPEC 4609 4710 2.29e-22 SMART
SPEC 4717 4819 4.99e-14 SMART
SPEC 4826 4956 1.45e-10 SMART
EFh 4990 5018 5.08e-3 SMART
EFh 5026 5054 1.17e-2 SMART
GAS2 5065 5137 2.28e-54 SMART
low complexity region 5159 5204 N/A INTRINSIC
low complexity region 5253 5278 N/A INTRINSIC
low complexity region 5295 5307 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 93% (38/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit lethality before somitogenesis with failure of the primitive streak to form. Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(784) : Targeted(4) Gene trapped(780)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
Adamts20 T A 15: 94,184,252 (GRCm39) Q1517L probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Arhgef7 A G 8: 11,869,659 (GRCm39) T432A possibly damaging Het
Atad2b A G 12: 5,081,784 (GRCm39) N1231S probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
Atp8b3 T C 10: 80,370,032 (GRCm39) N127S probably damaging Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Birc6 T A 17: 74,872,856 (GRCm39) S372T probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cdh18 T A 15: 23,474,081 (GRCm39) D650E probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Cep152 A G 2: 125,436,819 (GRCm39) S574P probably benign Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cib4 T C 5: 30,645,938 (GRCm39) D110G probably damaging Het
Col9a2 T A 4: 120,896,985 (GRCm39) probably null Het
Csmd2 A T 4: 128,389,981 (GRCm39) I2239F possibly damaging Het
Csmd3 C A 15: 47,522,485 (GRCm39) G2728V probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Cyp2d11 A G 15: 82,273,730 (GRCm39) L416P possibly damaging Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Depdc5 T A 5: 33,144,310 (GRCm39) M1435K possibly damaging Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dld A T 12: 31,384,053 (GRCm39) I350N probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Gm4847 A G 1: 166,457,824 (GRCm39) S510P probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ibtk T C 9: 85,625,630 (GRCm39) Y40C probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Ift172 C T 5: 31,422,699 (GRCm39) R917H probably benign Het
Itgae C T 11: 73,029,335 (GRCm39) Q1037* probably null Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Mark1 A C 1: 184,653,801 (GRCm39) V167G probably damaging Het
Mrgprf T A 7: 144,861,993 (GRCm39) L185Q probably damaging Het
Mtor T A 4: 148,634,645 (GRCm39) V2422D probably damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Or8b48 T A 9: 38,492,579 (GRCm39) V2D possibly damaging Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Pde1c A G 6: 56,338,800 (GRCm39) F11L probably benign Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Piezo2 T C 18: 63,148,873 (GRCm39) Y2659C probably damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Plxnb1 T C 9: 108,931,210 (GRCm39) V410A possibly damaging Het
Pramel26 T C 4: 143,538,428 (GRCm39) Y181C probably damaging Het
Ptger2 A G 14: 45,226,957 (GRCm39) Y179C probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rcan1 A T 16: 92,190,408 (GRCm39) M177K probably benign Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Rpa1 C T 11: 75,203,799 (GRCm39) probably null Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Sel1l T C 12: 91,791,634 (GRCm39) Y309C probably damaging Het
Setd1b GCCCCCCC GCCCCCCCCCCCCC 5: 123,298,766 (GRCm39) probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Spef2 A G 15: 9,716,482 (GRCm39) F368S probably damaging Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Stat4 A G 1: 52,135,979 (GRCm39) I429M probably damaging Het
Stkld1 A T 2: 26,841,462 (GRCm39) Q469L probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Tmem81 G A 1: 132,435,662 (GRCm39) R156Q probably damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn1r120 A G 7: 20,786,941 (GRCm39) C257R probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Vwf A G 6: 125,619,969 (GRCm39) E1549G probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Macf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Macf1 APN 4 123,275,915 (GRCm39) missense probably damaging 0.99
IGL01293:Macf1 APN 4 123,365,104 (GRCm39) missense probably benign 0.00
IGL01307:Macf1 APN 4 123,276,922 (GRCm39) missense probably damaging 1.00
IGL01314:Macf1 APN 4 123,380,513 (GRCm39) missense probably damaging 1.00
IGL01321:Macf1 APN 4 123,334,567 (GRCm39) missense probably damaging 1.00
IGL01327:Macf1 APN 4 123,403,705 (GRCm39) missense probably benign 0.20
IGL01365:Macf1 APN 4 123,284,962 (GRCm39) missense probably damaging 1.00
IGL01465:Macf1 APN 4 123,384,514 (GRCm39) missense probably benign 0.00
IGL01527:Macf1 APN 4 123,386,953 (GRCm39) missense possibly damaging 0.93
IGL01533:Macf1 APN 4 123,367,666 (GRCm39) missense probably damaging 1.00
IGL01539:Macf1 APN 4 123,289,701 (GRCm39) splice site probably benign
IGL01543:Macf1 APN 4 123,295,250 (GRCm39) missense probably damaging 1.00
IGL01553:Macf1 APN 4 123,386,956 (GRCm39) nonsense probably null
IGL01558:Macf1 APN 4 123,346,798 (GRCm39) missense probably benign 0.00
IGL01633:Macf1 APN 4 123,395,964 (GRCm39) missense probably damaging 0.99
IGL01684:Macf1 APN 4 123,359,723 (GRCm39) missense probably damaging 1.00
IGL01715:Macf1 APN 4 123,284,879 (GRCm39) missense probably damaging 1.00
IGL01844:Macf1 APN 4 123,334,485 (GRCm39) missense probably benign 0.34
IGL01870:Macf1 APN 4 123,367,906 (GRCm39) missense probably damaging 0.99
IGL01916:Macf1 APN 4 123,335,423 (GRCm39) missense probably damaging 1.00
IGL01916:Macf1 APN 4 123,369,830 (GRCm39) missense probably damaging 1.00
IGL01923:Macf1 APN 4 123,274,237 (GRCm39) missense possibly damaging 0.46
IGL02017:Macf1 APN 4 123,393,724 (GRCm39) missense probably damaging 1.00
IGL02022:Macf1 APN 4 123,284,842 (GRCm39) critical splice donor site probably null
IGL02084:Macf1 APN 4 123,326,396 (GRCm39) missense probably benign 0.02
IGL02084:Macf1 APN 4 123,353,167 (GRCm39) missense probably damaging 1.00
IGL02142:Macf1 APN 4 123,365,842 (GRCm39) missense probably benign 0.11
IGL02151:Macf1 APN 4 123,265,559 (GRCm39) splice site probably benign
IGL02164:Macf1 APN 4 123,374,065 (GRCm39) missense probably benign 0.03
IGL02174:Macf1 APN 4 123,385,587 (GRCm39) missense probably damaging 1.00
IGL02229:Macf1 APN 4 123,403,619 (GRCm39) missense probably damaging 1.00
IGL02277:Macf1 APN 4 123,380,497 (GRCm39) missense probably damaging 1.00
IGL02283:Macf1 APN 4 123,365,168 (GRCm39) missense probably benign 0.01
IGL02314:Macf1 APN 4 123,338,630 (GRCm39) missense probably damaging 0.99
IGL02327:Macf1 APN 4 123,365,523 (GRCm39) missense probably benign 0.06
IGL02348:Macf1 APN 4 123,406,659 (GRCm39) missense probably damaging 1.00
IGL02441:Macf1 APN 4 123,281,029 (GRCm39) missense probably damaging 1.00
IGL02585:Macf1 APN 4 123,366,077 (GRCm39) missense probably benign 0.00
IGL02602:Macf1 APN 4 123,248,956 (GRCm39) missense probably damaging 1.00
IGL03204:Macf1 APN 4 123,249,070 (GRCm39) splice site probably benign
anakex UTSW 4 123,302,064 (GRCm39) missense probably damaging 0.97
esfuerzo UTSW 4 123,369,922 (GRCm39) missense probably benign 0.22
Royal_flush UTSW 4 123,259,148 (GRCm39) splice site probably null
standard UTSW 4 123,380,199 (GRCm39) missense probably damaging 1.00
suspension UTSW 4 123,391,548 (GRCm39) missense probably damaging 1.00
voragine UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
BB010:Macf1 UTSW 4 123,303,444 (GRCm39) missense probably benign 0.00
BB020:Macf1 UTSW 4 123,303,444 (GRCm39) missense probably benign 0.00
H8562:Macf1 UTSW 4 123,359,833 (GRCm39) missense probably benign 0.13
IGL03052:Macf1 UTSW 4 123,281,188 (GRCm39) missense probably damaging 1.00
N/A - 535:Macf1 UTSW 4 123,367,601 (GRCm39) missense possibly damaging 0.82
PIT4576001:Macf1 UTSW 4 123,367,114 (GRCm39) missense probably benign 0.43
R0021:Macf1 UTSW 4 123,369,370 (GRCm39) missense probably damaging 1.00
R0023:Macf1 UTSW 4 123,382,107 (GRCm39) splice site probably benign
R0023:Macf1 UTSW 4 123,382,107 (GRCm39) splice site probably benign
R0028:Macf1 UTSW 4 123,275,895 (GRCm39) missense probably damaging 1.00
R0066:Macf1 UTSW 4 123,325,943 (GRCm39) nonsense probably null
R0066:Macf1 UTSW 4 123,325,943 (GRCm39) nonsense probably null
R0067:Macf1 UTSW 4 123,369,041 (GRCm39) missense possibly damaging 0.90
R0067:Macf1 UTSW 4 123,369,041 (GRCm39) missense possibly damaging 0.90
R0078:Macf1 UTSW 4 123,367,661 (GRCm39) missense probably damaging 1.00
R0106:Macf1 UTSW 4 123,302,357 (GRCm39) missense probably benign 0.00
R0123:Macf1 UTSW 4 123,326,636 (GRCm39) missense possibly damaging 0.78
R0129:Macf1 UTSW 4 123,327,068 (GRCm39) missense probably damaging 1.00
R0134:Macf1 UTSW 4 123,326,636 (GRCm39) missense possibly damaging 0.78
R0138:Macf1 UTSW 4 123,334,540 (GRCm39) missense probably damaging 1.00
R0145:Macf1 UTSW 4 123,281,190 (GRCm39) missense probably damaging 1.00
R0195:Macf1 UTSW 4 123,328,709 (GRCm39) missense probably damaging 0.99
R0227:Macf1 UTSW 4 123,293,184 (GRCm39) missense probably benign 0.14
R0233:Macf1 UTSW 4 123,343,920 (GRCm39) splice site probably benign
R0254:Macf1 UTSW 4 123,326,572 (GRCm39) missense probably damaging 1.00
R0357:Macf1 UTSW 4 123,351,776 (GRCm39) missense probably damaging 1.00
R0398:Macf1 UTSW 4 123,244,810 (GRCm39) missense probably damaging 1.00
R0413:Macf1 UTSW 4 123,366,062 (GRCm39) missense probably benign
R0426:Macf1 UTSW 4 123,377,453 (GRCm39) nonsense probably null
R0441:Macf1 UTSW 4 123,259,148 (GRCm39) splice site probably null
R0453:Macf1 UTSW 4 123,338,737 (GRCm39) missense probably benign 0.35
R0481:Macf1 UTSW 4 123,377,815 (GRCm39) splice site probably null
R0502:Macf1 UTSW 4 123,363,608 (GRCm39) missense probably damaging 1.00
R0503:Macf1 UTSW 4 123,363,608 (GRCm39) missense probably damaging 1.00
R0519:Macf1 UTSW 4 123,365,113 (GRCm39) missense probably benign 0.03
R0543:Macf1 UTSW 4 123,270,171 (GRCm39) missense probably damaging 1.00
R0621:Macf1 UTSW 4 123,274,327 (GRCm39) missense probably damaging 1.00
R0631:Macf1 UTSW 4 123,349,317 (GRCm39) nonsense probably null
R0720:Macf1 UTSW 4 123,326,718 (GRCm39) missense probably damaging 1.00
R0730:Macf1 UTSW 4 123,276,323 (GRCm39) splice site probably benign
R0755:Macf1 UTSW 4 123,263,719 (GRCm39) missense probably damaging 0.99
R0836:Macf1 UTSW 4 123,388,675 (GRCm39) critical splice donor site probably null
R0847:Macf1 UTSW 4 123,293,159 (GRCm39) missense probably benign 0.03
R0850:Macf1 UTSW 4 123,368,195 (GRCm39) missense probably benign
R0924:Macf1 UTSW 4 123,279,271 (GRCm39) missense probably damaging 1.00
R1025:Macf1 UTSW 4 123,367,609 (GRCm39) missense probably damaging 1.00
R1076:Macf1 UTSW 4 123,279,391 (GRCm39) missense probably damaging 1.00
R1253:Macf1 UTSW 4 123,351,760 (GRCm39) missense probably damaging 1.00
R1301:Macf1 UTSW 4 123,380,451 (GRCm39) splice site probably benign
R1337:Macf1 UTSW 4 123,370,068 (GRCm39) missense probably benign 0.34
R1344:Macf1 UTSW 4 123,327,246 (GRCm39) missense probably damaging 0.99
R1404:Macf1 UTSW 4 123,270,309 (GRCm39) missense probably damaging 1.00
R1404:Macf1 UTSW 4 123,270,309 (GRCm39) missense probably damaging 1.00
R1443:Macf1 UTSW 4 123,404,800 (GRCm39) missense probably damaging 1.00
R1452:Macf1 UTSW 4 123,387,791 (GRCm39) missense probably benign
R1465:Macf1 UTSW 4 123,386,947 (GRCm39) missense probably damaging 0.98
R1465:Macf1 UTSW 4 123,386,947 (GRCm39) missense probably damaging 0.98
R1483:Macf1 UTSW 4 123,404,770 (GRCm39) missense probably damaging 1.00
R1509:Macf1 UTSW 4 123,577,802 (GRCm39) missense possibly damaging 0.92
R1510:Macf1 UTSW 4 123,328,555 (GRCm39) missense probably null 1.00
R1515:Macf1 UTSW 4 123,272,273 (GRCm39) missense probably damaging 1.00
R1524:Macf1 UTSW 4 123,326,323 (GRCm39) missense possibly damaging 0.75
R1528:Macf1 UTSW 4 123,369,807 (GRCm39) missense probably benign 0.30
R1535:Macf1 UTSW 4 123,334,486 (GRCm39) missense probably benign 0.05
R1556:Macf1 UTSW 4 123,348,813 (GRCm39) missense probably damaging 1.00
R1564:Macf1 UTSW 4 123,353,150 (GRCm39) missense probably benign 0.00
R1586:Macf1 UTSW 4 123,403,639 (GRCm39) missense probably benign 0.20
R1626:Macf1 UTSW 4 123,365,327 (GRCm39) missense probably benign
R1629:Macf1 UTSW 4 123,402,208 (GRCm39) nonsense probably null
R1649:Macf1 UTSW 4 123,377,846 (GRCm39) missense probably damaging 0.96
R1650:Macf1 UTSW 4 123,350,393 (GRCm39) nonsense probably null
R1706:Macf1 UTSW 4 123,264,377 (GRCm39) critical splice donor site probably null
R1713:Macf1 UTSW 4 123,272,487 (GRCm39) missense probably damaging 1.00
R1716:Macf1 UTSW 4 123,295,196 (GRCm39) missense probably damaging 1.00
R1744:Macf1 UTSW 4 123,369,646 (GRCm39) missense probably damaging 1.00
R1752:Macf1 UTSW 4 123,377,465 (GRCm39) missense possibly damaging 0.92
R1771:Macf1 UTSW 4 123,405,901 (GRCm39) missense probably damaging 1.00
R1812:Macf1 UTSW 4 123,325,817 (GRCm39) missense probably damaging 1.00
R1818:Macf1 UTSW 4 123,270,210 (GRCm39) missense probably damaging 1.00
R1853:Macf1 UTSW 4 123,406,513 (GRCm39) splice site probably null
R1856:Macf1 UTSW 4 123,263,641 (GRCm39) missense probably damaging 1.00
R1869:Macf1 UTSW 4 123,244,921 (GRCm39) missense probably damaging 1.00
R1880:Macf1 UTSW 4 123,332,384 (GRCm39) missense probably damaging 1.00
R1888:Macf1 UTSW 4 123,368,505 (GRCm39) missense probably benign
R1888:Macf1 UTSW 4 123,368,505 (GRCm39) missense probably benign
R1888:Macf1 UTSW 4 123,348,835 (GRCm39) missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123,348,835 (GRCm39) missense possibly damaging 0.91
R1902:Macf1 UTSW 4 123,364,958 (GRCm39) missense probably benign 0.01
R1907:Macf1 UTSW 4 123,266,192 (GRCm39) missense probably damaging 1.00
R1908:Macf1 UTSW 4 123,351,634 (GRCm39) missense possibly damaging 0.67
R1932:Macf1 UTSW 4 123,345,830 (GRCm39) missense probably damaging 1.00
R1944:Macf1 UTSW 4 123,264,459 (GRCm39) missense probably damaging 1.00
R1945:Macf1 UTSW 4 123,384,453 (GRCm39) nonsense probably null
R1975:Macf1 UTSW 4 123,383,005 (GRCm39) missense probably damaging 1.00
R1989:Macf1 UTSW 4 123,391,519 (GRCm39) critical splice donor site probably null
R1991:Macf1 UTSW 4 123,350,488 (GRCm39) missense probably damaging 1.00
R1992:Macf1 UTSW 4 123,350,488 (GRCm39) missense probably damaging 1.00
R2013:Macf1 UTSW 4 123,577,807 (GRCm39) missense probably damaging 1.00
R2021:Macf1 UTSW 4 123,366,523 (GRCm39) missense probably damaging 1.00
R2022:Macf1 UTSW 4 123,366,523 (GRCm39) missense probably damaging 1.00
R2023:Macf1 UTSW 4 123,366,523 (GRCm39) missense probably damaging 1.00
R2024:Macf1 UTSW 4 123,265,711 (GRCm39) missense probably damaging 1.00
R2025:Macf1 UTSW 4 123,265,711 (GRCm39) missense probably damaging 1.00
R2027:Macf1 UTSW 4 123,265,711 (GRCm39) missense probably damaging 1.00
R2049:Macf1 UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
R2060:Macf1 UTSW 4 123,393,712 (GRCm39) splice site probably null
R2092:Macf1 UTSW 4 123,276,971 (GRCm39) missense probably damaging 1.00
R2100:Macf1 UTSW 4 123,291,699 (GRCm39) nonsense probably null
R2128:Macf1 UTSW 4 123,386,567 (GRCm39) missense probably benign 0.11
R2129:Macf1 UTSW 4 123,262,608 (GRCm39) splice site probably benign
R2140:Macf1 UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
R2142:Macf1 UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
R2182:Macf1 UTSW 4 123,386,464 (GRCm39) missense probably damaging 0.98
R2185:Macf1 UTSW 4 123,369,349 (GRCm39) missense probably damaging 0.99
R2190:Macf1 UTSW 4 123,353,005 (GRCm39) missense probably benign 0.11
R2320:Macf1 UTSW 4 123,333,288 (GRCm39) missense probably benign 0.02
R2382:Macf1 UTSW 4 123,268,625 (GRCm39) missense probably damaging 1.00
R2429:Macf1 UTSW 4 123,326,377 (GRCm39) missense probably damaging 0.99
R2432:Macf1 UTSW 4 123,577,789 (GRCm39) missense probably damaging 1.00
R2484:Macf1 UTSW 4 123,367,465 (GRCm39) missense probably damaging 1.00
R2842:Macf1 UTSW 4 123,270,210 (GRCm39) missense probably damaging 1.00
R2912:Macf1 UTSW 4 123,369,704 (GRCm39) missense probably damaging 1.00
R2913:Macf1 UTSW 4 123,369,704 (GRCm39) missense probably damaging 1.00
R2914:Macf1 UTSW 4 123,369,704 (GRCm39) missense probably damaging 1.00
R2938:Macf1 UTSW 4 123,326,695 (GRCm39) missense probably damaging 0.99
R3082:Macf1 UTSW 4 123,255,236 (GRCm39) splice site probably null
R3086:Macf1 UTSW 4 123,328,901 (GRCm39) missense probably benign 0.00
R3408:Macf1 UTSW 4 123,275,574 (GRCm39) missense probably damaging 1.00
R3499:Macf1 UTSW 4 123,421,098 (GRCm39) nonsense probably null
R3696:Macf1 UTSW 4 123,350,155 (GRCm39) missense probably damaging 1.00
R3716:Macf1 UTSW 4 123,367,295 (GRCm39) missense probably benign 0.01
R3727:Macf1 UTSW 4 123,353,104 (GRCm39) missense probably damaging 1.00
R3770:Macf1 UTSW 4 123,268,560 (GRCm39) missense probably damaging 1.00
R3813:Macf1 UTSW 4 123,268,560 (GRCm39) missense probably damaging 1.00
R3825:Macf1 UTSW 4 123,338,744 (GRCm39) missense probably benign 0.11
R3893:Macf1 UTSW 4 123,380,199 (GRCm39) missense probably damaging 1.00
R3896:Macf1 UTSW 4 123,364,987 (GRCm39) missense possibly damaging 0.55
R3947:Macf1 UTSW 4 123,274,213 (GRCm39) missense probably damaging 1.00
R4031:Macf1 UTSW 4 123,275,105 (GRCm39) missense probably damaging 1.00
R4052:Macf1 UTSW 4 123,365,810 (GRCm39) missense probably benign 0.00
R4077:Macf1 UTSW 4 123,365,884 (GRCm39) missense probably benign 0.07
R4078:Macf1 UTSW 4 123,365,884 (GRCm39) missense probably benign 0.07
R4084:Macf1 UTSW 4 123,343,865 (GRCm39) missense probably damaging 0.98
R4094:Macf1 UTSW 4 123,353,062 (GRCm39) missense probably benign 0.00
R4154:Macf1 UTSW 4 123,365,606 (GRCm39) missense probably damaging 1.00
R4190:Macf1 UTSW 4 123,366,835 (GRCm39) missense possibly damaging 0.95
R4191:Macf1 UTSW 4 123,366,835 (GRCm39) missense possibly damaging 0.95
R4192:Macf1 UTSW 4 123,366,835 (GRCm39) missense possibly damaging 0.95
R4232:Macf1 UTSW 4 123,326,185 (GRCm39) missense probably damaging 1.00
R4299:Macf1 UTSW 4 123,293,199 (GRCm39) missense probably damaging 1.00
R4326:Macf1 UTSW 4 123,276,005 (GRCm39) missense probably damaging 1.00
R4327:Macf1 UTSW 4 123,276,005 (GRCm39) missense probably damaging 1.00
R4355:Macf1 UTSW 4 123,368,884 (GRCm39) missense possibly damaging 0.79
R4380:Macf1 UTSW 4 123,248,285 (GRCm39) intron probably benign
R4422:Macf1 UTSW 4 123,359,839 (GRCm39) missense probably damaging 0.96
R4436:Macf1 UTSW 4 123,421,135 (GRCm39) missense probably benign 0.03
R4472:Macf1 UTSW 4 123,289,782 (GRCm39) missense probably damaging 1.00
R4515:Macf1 UTSW 4 123,387,781 (GRCm39) missense probably damaging 1.00
R4549:Macf1 UTSW 4 123,367,486 (GRCm39) missense possibly damaging 0.75
R4621:Macf1 UTSW 4 123,266,141 (GRCm39) critical splice donor site probably null
R4622:Macf1 UTSW 4 123,266,141 (GRCm39) critical splice donor site probably null
R4623:Macf1 UTSW 4 123,266,141 (GRCm39) critical splice donor site probably null
R4630:Macf1 UTSW 4 123,367,432 (GRCm39) missense possibly damaging 0.84
R4647:Macf1 UTSW 4 123,367,420 (GRCm39) missense probably benign 0.01
R4650:Macf1 UTSW 4 123,367,412 (GRCm39) missense probably benign 0.00
R4674:Macf1 UTSW 4 123,366,190 (GRCm39) missense probably benign 0.22
R4751:Macf1 UTSW 4 123,365,443 (GRCm39) missense probably benign 0.01
R4762:Macf1 UTSW 4 123,349,237 (GRCm39) missense probably benign 0.00
R4776:Macf1 UTSW 4 123,369,808 (GRCm39) missense probably benign 0.00
R4777:Macf1 UTSW 4 123,270,295 (GRCm39) missense probably damaging 1.00
R4860:Macf1 UTSW 4 123,380,543 (GRCm39) missense probably damaging 1.00
R4860:Macf1 UTSW 4 123,380,543 (GRCm39) missense probably damaging 1.00
R4865:Macf1 UTSW 4 123,327,096 (GRCm39) missense probably damaging 1.00
R4867:Macf1 UTSW 4 123,365,993 (GRCm39) missense probably damaging 0.97
R4884:Macf1 UTSW 4 123,348,802 (GRCm39) missense probably benign 0.02
R4890:Macf1 UTSW 4 123,342,031 (GRCm39) missense probably damaging 1.00
R4913:Macf1 UTSW 4 123,393,682 (GRCm39) missense probably damaging 1.00
R4925:Macf1 UTSW 4 123,420,445 (GRCm39) missense probably benign
R4948:Macf1 UTSW 4 123,391,548 (GRCm39) missense probably damaging 1.00
R4958:Macf1 UTSW 4 123,369,157 (GRCm39) missense probably damaging 0.99
R4986:Macf1 UTSW 4 123,284,914 (GRCm39) missense probably damaging 1.00
R4999:Macf1 UTSW 4 123,388,702 (GRCm39) missense probably benign 0.14
R5004:Macf1 UTSW 4 123,279,268 (GRCm39) missense probably damaging 1.00
R5017:Macf1 UTSW 4 123,345,906 (GRCm39) missense probably damaging 1.00
R5018:Macf1 UTSW 4 123,279,392 (GRCm39) missense probably damaging 1.00
R5026:Macf1 UTSW 4 123,333,287 (GRCm39) missense possibly damaging 0.95
R5037:Macf1 UTSW 4 123,349,312 (GRCm39) missense probably damaging 0.97
R5039:Macf1 UTSW 4 123,405,013 (GRCm39) missense probably damaging 1.00
R5041:Macf1 UTSW 4 123,290,839 (GRCm39) splice site probably null
R5100:Macf1 UTSW 4 123,368,261 (GRCm39) missense probably benign 0.11
R5110:Macf1 UTSW 4 123,261,801 (GRCm39) missense probably damaging 0.99
R5122:Macf1 UTSW 4 123,346,085 (GRCm39) missense probably damaging 1.00
R5187:Macf1 UTSW 4 123,365,882 (GRCm39) missense probably benign 0.00
R5191:Macf1 UTSW 4 123,366,755 (GRCm39) missense probably benign 0.00
R5201:Macf1 UTSW 4 123,369,738 (GRCm39) nonsense probably null
R5236:Macf1 UTSW 4 123,291,614 (GRCm39) missense probably damaging 1.00
R5248:Macf1 UTSW 4 123,295,567 (GRCm39) nonsense probably null
R5251:Macf1 UTSW 4 123,343,760 (GRCm39) missense probably benign 0.20
R5319:Macf1 UTSW 4 123,367,229 (GRCm39) missense probably damaging 1.00
R5326:Macf1 UTSW 4 123,244,784 (GRCm39) frame shift probably null
R5327:Macf1 UTSW 4 123,244,784 (GRCm39) frame shift probably null
R5328:Macf1 UTSW 4 123,244,784 (GRCm39) frame shift probably null
R5350:Macf1 UTSW 4 123,421,251 (GRCm39) start codon destroyed probably null 0.02
R5390:Macf1 UTSW 4 123,365,546 (GRCm39) missense probably damaging 0.98
R5419:Macf1 UTSW 4 123,290,917 (GRCm39) missense possibly damaging 0.70
R5428:Macf1 UTSW 4 123,278,661 (GRCm39) missense probably damaging 1.00
R5432:Macf1 UTSW 4 123,353,129 (GRCm39) nonsense probably null
R5466:Macf1 UTSW 4 123,346,658 (GRCm39) missense possibly damaging 0.75
R5472:Macf1 UTSW 4 123,343,854 (GRCm39) missense probably benign
R5564:Macf1 UTSW 4 123,420,538 (GRCm39) missense possibly damaging 0.92
R5566:Macf1 UTSW 4 123,328,957 (GRCm39) missense probably damaging 0.98
R5597:Macf1 UTSW 4 123,433,570 (GRCm39) intron probably benign
R5669:Macf1 UTSW 4 123,370,018 (GRCm39) missense probably damaging 1.00
R5682:Macf1 UTSW 4 123,328,552 (GRCm39) missense probably damaging 1.00
R5701:Macf1 UTSW 4 123,397,018 (GRCm39) missense probably damaging 1.00
R5715:Macf1 UTSW 4 123,577,807 (GRCm39) missense probably damaging 1.00
R5760:Macf1 UTSW 4 123,407,677 (GRCm39) missense probably damaging 1.00
R5806:Macf1 UTSW 4 123,265,680 (GRCm39) missense probably damaging 1.00
R5838:Macf1 UTSW 4 123,345,947 (GRCm39) missense possibly damaging 0.95
R5839:Macf1 UTSW 4 123,275,117 (GRCm39) missense probably damaging 1.00
R5850:Macf1 UTSW 4 123,401,099 (GRCm39) missense probably damaging 1.00
R5875:Macf1 UTSW 4 123,326,107 (GRCm39) missense possibly damaging 0.78
R5912:Macf1 UTSW 4 123,290,951 (GRCm39) missense probably damaging 1.00
R5913:Macf1 UTSW 4 123,369,832 (GRCm39) missense probably damaging 1.00
R5921:Macf1 UTSW 4 123,420,504 (GRCm39) missense probably benign
R5940:Macf1 UTSW 4 123,326,674 (GRCm39) missense probably damaging 1.00
R5950:Macf1 UTSW 4 123,333,229 (GRCm39) splice site probably null
R6005:Macf1 UTSW 4 123,368,068 (GRCm39) missense possibly damaging 0.82
R6029:Macf1 UTSW 4 123,401,126 (GRCm39) missense probably damaging 1.00
R6041:Macf1 UTSW 4 123,407,641 (GRCm39) missense probably damaging 1.00
R6057:Macf1 UTSW 4 123,404,536 (GRCm39) missense probably damaging 0.98
R6156:Macf1 UTSW 4 123,366,073 (GRCm39) missense probably benign 0.00
R6186:Macf1 UTSW 4 123,377,968 (GRCm39) missense probably damaging 1.00
R6197:Macf1 UTSW 4 123,346,085 (GRCm39) missense probably damaging 1.00
R6262:Macf1 UTSW 4 123,366,983 (GRCm39) missense possibly damaging 0.79
R6296:Macf1 UTSW 4 123,326,668 (GRCm39) missense probably damaging 1.00
R6340:Macf1 UTSW 4 123,342,042 (GRCm39) missense probably benign 0.13
R6369:Macf1 UTSW 4 123,304,355 (GRCm39) missense possibly damaging 0.90
R6414:Macf1 UTSW 4 123,386,988 (GRCm39) missense possibly damaging 0.93
R6429:Macf1 UTSW 4 123,295,387 (GRCm39) splice site probably null
R6501:Macf1 UTSW 4 123,363,425 (GRCm39) splice site probably null
R6508:Macf1 UTSW 4 123,363,535 (GRCm39) missense probably damaging 0.96
R6519:Macf1 UTSW 4 123,366,118 (GRCm39) missense probably benign 0.13
R6535:Macf1 UTSW 4 123,365,728 (GRCm39) missense possibly damaging 0.82
R6537:Macf1 UTSW 4 123,386,518 (GRCm39) missense probably damaging 1.00
R6546:Macf1 UTSW 4 123,326,074 (GRCm39) missense probably benign 0.14
R6583:Macf1 UTSW 4 123,364,739 (GRCm39) splice site probably null
R6597:Macf1 UTSW 4 123,276,485 (GRCm39) missense probably damaging 1.00
R6693:Macf1 UTSW 4 123,367,601 (GRCm39) missense possibly damaging 0.82
R6696:Macf1 UTSW 4 123,403,596 (GRCm39) missense probably damaging 1.00
R6704:Macf1 UTSW 4 123,304,555 (GRCm39) intron probably benign
R6716:Macf1 UTSW 4 123,402,231 (GRCm39) missense probably damaging 1.00
R6789:Macf1 UTSW 4 123,266,231 (GRCm39) missense probably damaging 1.00
R6807:Macf1 UTSW 4 123,268,208 (GRCm39) missense probably damaging 1.00
R6825:Macf1 UTSW 4 123,277,015 (GRCm39) splice site probably null
R6881:Macf1 UTSW 4 123,326,246 (GRCm39) missense probably damaging 1.00
R6894:Macf1 UTSW 4 123,377,480 (GRCm39) missense possibly damaging 0.89
R6924:Macf1 UTSW 4 123,421,145 (GRCm39) missense possibly damaging 0.53
R6962:Macf1 UTSW 4 123,334,515 (GRCm39) missense probably benign 0.01
R6965:Macf1 UTSW 4 123,302,538 (GRCm39) missense probably benign 0.38
R6969:Macf1 UTSW 4 123,351,593 (GRCm39) missense probably benign 0.01
R7032:Macf1 UTSW 4 123,366,101 (GRCm39) missense probably benign 0.00
R7055:Macf1 UTSW 4 123,302,989 (GRCm39) missense probably benign 0.01
R7078:Macf1 UTSW 4 123,325,936 (GRCm39) missense probably damaging 0.99
R7215:Macf1 UTSW 4 123,401,097 (GRCm39) missense probably damaging 1.00
R7263:Macf1 UTSW 4 123,271,943 (GRCm39) missense probably damaging 1.00
R7265:Macf1 UTSW 4 123,301,670 (GRCm39) missense probably benign 0.00
R7278:Macf1 UTSW 4 123,334,536 (GRCm39) missense possibly damaging 0.87
R7312:Macf1 UTSW 4 123,400,130 (GRCm39) missense probably damaging 1.00
R7324:Macf1 UTSW 4 123,268,218 (GRCm39) missense probably benign 0.09
R7334:Macf1 UTSW 4 123,293,235 (GRCm39) missense probably damaging 1.00
R7342:Macf1 UTSW 4 123,275,917 (GRCm39) missense probably damaging 1.00
R7409:Macf1 UTSW 4 123,398,263 (GRCm39) missense probably damaging 1.00
R7436:Macf1 UTSW 4 123,350,436 (GRCm39) missense probably benign
R7440:Macf1 UTSW 4 123,349,239 (GRCm39) nonsense probably null
R7462:Macf1 UTSW 4 123,386,556 (GRCm39) missense probably damaging 1.00
R7471:Macf1 UTSW 4 123,366,082 (GRCm39) missense probably benign 0.00
R7472:Macf1 UTSW 4 123,326,860 (GRCm39) missense probably benign 0.16
R7486:Macf1 UTSW 4 123,303,374 (GRCm39) missense probably benign 0.00
R7492:Macf1 UTSW 4 123,369,524 (GRCm39) missense possibly damaging 0.83
R7511:Macf1 UTSW 4 123,367,093 (GRCm39) missense possibly damaging 0.72
R7528:Macf1 UTSW 4 123,325,852 (GRCm39) missense possibly damaging 0.90
R7547:Macf1 UTSW 4 123,335,410 (GRCm39) missense probably damaging 1.00
R7592:Macf1 UTSW 4 123,304,686 (GRCm39) intron probably benign
R7723:Macf1 UTSW 4 123,326,717 (GRCm39) missense probably benign 0.00
R7731:Macf1 UTSW 4 123,338,672 (GRCm39) missense probably benign 0.19
R7739:Macf1 UTSW 4 123,279,391 (GRCm39) missense probably damaging 1.00
R7740:Macf1 UTSW 4 123,578,096 (GRCm39) start gained probably benign
R7798:Macf1 UTSW 4 123,271,893 (GRCm39) missense probably damaging 1.00
R7799:Macf1 UTSW 4 123,420,906 (GRCm39) missense probably benign 0.00
R7801:Macf1 UTSW 4 123,302,064 (GRCm39) missense probably damaging 0.97
R7842:Macf1 UTSW 4 123,420,702 (GRCm39) missense probably benign 0.12
R7849:Macf1 UTSW 4 123,301,392 (GRCm39) missense probably benign 0.00
R7873:Macf1 UTSW 4 123,398,344 (GRCm39) critical splice acceptor site probably null
R7933:Macf1 UTSW 4 123,303,444 (GRCm39) missense probably benign 0.00
R7934:Macf1 UTSW 4 123,367,727 (GRCm39) missense possibly damaging 0.89
R7947:Macf1 UTSW 4 123,295,200 (GRCm39) missense probably damaging 0.98
R7988:Macf1 UTSW 4 123,400,273 (GRCm39) missense probably damaging 1.00
R7992:Macf1 UTSW 4 123,289,753 (GRCm39) missense probably damaging 1.00
R8013:Macf1 UTSW 4 123,420,619 (GRCm39) missense probably benign 0.00
R8014:Macf1 UTSW 4 123,420,619 (GRCm39) missense probably benign 0.00
R8029:Macf1 UTSW 4 123,338,685 (GRCm39) missense possibly damaging 0.50
R8064:Macf1 UTSW 4 123,353,167 (GRCm39) missense possibly damaging 0.91
R8085:Macf1 UTSW 4 123,303,875 (GRCm39) missense possibly damaging 0.46
R8094:Macf1 UTSW 4 123,263,660 (GRCm39) missense probably damaging 0.99
R8099:Macf1 UTSW 4 123,369,922 (GRCm39) missense probably benign 0.22
R8147:Macf1 UTSW 4 123,385,491 (GRCm39) missense probably damaging 1.00
R8151:Macf1 UTSW 4 123,291,206 (GRCm39) missense possibly damaging 0.91
R8186:Macf1 UTSW 4 123,275,923 (GRCm39) missense possibly damaging 0.89
R8186:Macf1 UTSW 4 123,266,219 (GRCm39) missense probably damaging 1.00
R8192:Macf1 UTSW 4 123,334,390 (GRCm39) missense probably damaging 1.00
R8196:Macf1 UTSW 4 123,276,497 (GRCm39) missense probably damaging 1.00
R8260:Macf1 UTSW 4 123,365,863 (GRCm39) missense probably benign
R8305:Macf1 UTSW 4 123,289,414 (GRCm39) intron probably benign
R8333:Macf1 UTSW 4 123,279,245 (GRCm39) splice site probably null
R8334:Macf1 UTSW 4 123,325,901 (GRCm39) missense possibly damaging 0.82
R8344:Macf1 UTSW 4 123,420,649 (GRCm39) missense probably benign
R8344:Macf1 UTSW 4 123,278,476 (GRCm39) missense probably damaging 1.00
R8422:Macf1 UTSW 4 123,303,279 (GRCm39) missense possibly damaging 0.46
R8459:Macf1 UTSW 4 123,374,107 (GRCm39) missense possibly damaging 0.68
R8466:Macf1 UTSW 4 123,349,237 (GRCm39) missense probably benign 0.00
R8472:Macf1 UTSW 4 123,346,795 (GRCm39) missense probably damaging 1.00
R8556:Macf1 UTSW 4 123,382,136 (GRCm39) missense probably damaging 1.00
R8679:Macf1 UTSW 4 123,405,869 (GRCm39) missense probably benign 0.00
R8723:Macf1 UTSW 4 123,348,910 (GRCm39) nonsense probably null
R8732:Macf1 UTSW 4 123,403,563 (GRCm39) critical splice donor site probably null
R8747:Macf1 UTSW 4 123,248,944 (GRCm39) missense probably damaging 1.00
R8748:Macf1 UTSW 4 123,368,068 (GRCm39) missense probably benign 0.00
R8785:Macf1 UTSW 4 123,342,053 (GRCm39) critical splice acceptor site probably null
R8826:Macf1 UTSW 4 123,276,022 (GRCm39) missense probably damaging 1.00
R8828:Macf1 UTSW 4 123,302,204 (GRCm39) missense probably benign 0.01
R8833:Macf1 UTSW 4 123,365,134 (GRCm39) missense probably benign
R8889:Macf1 UTSW 4 123,249,036 (GRCm39) missense probably damaging 1.00
R8892:Macf1 UTSW 4 123,249,036 (GRCm39) missense probably damaging 1.00
R8893:Macf1 UTSW 4 123,304,323 (GRCm39) missense probably benign 0.27
R8899:Macf1 UTSW 4 123,368,852 (GRCm39) missense probably benign 0.00
R8956:Macf1 UTSW 4 123,368,641 (GRCm39) missense probably benign
R9037:Macf1 UTSW 4 123,365,518 (GRCm39) missense probably benign 0.03
R9086:Macf1 UTSW 4 123,377,944 (GRCm39) missense probably damaging 1.00
R9111:Macf1 UTSW 4 123,406,819 (GRCm39) missense probably damaging 1.00
R9126:Macf1 UTSW 4 123,276,193 (GRCm39) missense possibly damaging 0.88
R9139:Macf1 UTSW 4 123,328,564 (GRCm39) missense probably damaging 1.00
R9140:Macf1 UTSW 4 123,367,855 (GRCm39) missense possibly damaging 0.92
R9149:Macf1 UTSW 4 123,365,326 (GRCm39) missense probably benign 0.40
R9163:Macf1 UTSW 4 123,403,686 (GRCm39) missense probably damaging 1.00
R9177:Macf1 UTSW 4 123,367,582 (GRCm39) missense probably damaging 1.00
R9206:Macf1 UTSW 4 123,577,925 (GRCm39) missense unknown
R9208:Macf1 UTSW 4 123,577,925 (GRCm39) missense unknown
R9209:Macf1 UTSW 4 123,326,227 (GRCm39) missense probably damaging 1.00
R9219:Macf1 UTSW 4 123,301,554 (GRCm39) missense possibly damaging 0.81
R9224:Macf1 UTSW 4 123,326,690 (GRCm39) missense probably damaging 1.00
R9241:Macf1 UTSW 4 123,271,952 (GRCm39) missense probably damaging 1.00
R9268:Macf1 UTSW 4 123,367,582 (GRCm39) missense probably damaging 1.00
R9276:Macf1 UTSW 4 123,328,501 (GRCm39) missense probably damaging 1.00
R9296:Macf1 UTSW 4 123,400,246 (GRCm39) missense probably damaging 0.99
R9369:Macf1 UTSW 4 123,349,150 (GRCm39) critical splice donor site probably null
R9438:Macf1 UTSW 4 123,279,366 (GRCm39) missense probably benign 0.01
R9443:Macf1 UTSW 4 123,365,668 (GRCm39) missense probably benign
R9529:Macf1 UTSW 4 123,407,680 (GRCm39) missense probably damaging 1.00
R9600:Macf1 UTSW 4 123,365,002 (GRCm39) missense possibly damaging 0.76
R9613:Macf1 UTSW 4 123,420,288 (GRCm39) missense probably benign 0.41
R9686:Macf1 UTSW 4 123,377,491 (GRCm39) missense possibly damaging 0.64
R9689:Macf1 UTSW 4 123,365,654 (GRCm39) missense probably benign
R9740:Macf1 UTSW 4 123,366,853 (GRCm39) missense probably damaging 1.00
R9740:Macf1 UTSW 4 123,266,177 (GRCm39) missense probably damaging 1.00
R9764:Macf1 UTSW 4 123,366,136 (GRCm39) missense probably benign 0.02
R9779:Macf1 UTSW 4 123,348,789 (GRCm39) missense probably benign 0.02
RF011:Macf1 UTSW 4 123,367,648 (GRCm39) missense probably damaging 1.00
X0022:Macf1 UTSW 4 123,343,835 (GRCm39) missense probably damaging 0.99
X0027:Macf1 UTSW 4 123,397,062 (GRCm39) missense probably damaging 1.00
X0064:Macf1 UTSW 4 123,405,667 (GRCm39) missense probably damaging 1.00
Z1177:Macf1 UTSW 4 123,365,268 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTGACTCTTGATGGATGATAC -3'
(R):5'- AAGCTCTCCTTGGAAGAGGG -3'

Sequencing Primer
(F):5'- GGATGATACATCTCTGCATCAGGTC -3'
(R):5'- TCTCCTTGGAAGAGGGTCTCAC -3'
Posted On 2014-10-02