Incidental Mutation 'R0201:Adamdec1'
ID 23672
Institutional Source Beutler Lab
Gene Symbol Adamdec1
Ensembl Gene ENSMUSG00000022057
Gene Name ADAM-like, decysin 1
Synonyms Dcsn, 2210414L24Rik
MMRRC Submission 038458-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R0201 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 68800829-68819535 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 68819406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022641]
AlphaFold Q9R0X2
Predicted Effect probably null
Transcript: ENSMUST00000022641
SMART Domains Protein: ENSMUSP00000022641
Gene: ENSMUSG00000022057

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 37 175 3.9e-29 PFAM
Pfam:Reprolysin_5 215 389 9.8e-17 PFAM
Pfam:Reprolysin_4 216 407 7.3e-12 PFAM
Pfam:Reprolysin 217 411 1.5e-57 PFAM
Pfam:Reprolysin_3 242 360 1e-11 PFAM
DISIN 427 465 1.12e-3 SMART
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,927,763 (GRCm39) Q492L possibly damaging Het
Aplnr A G 2: 84,967,521 (GRCm39) D182G probably damaging Het
Arnt2 G T 7: 84,010,867 (GRCm39) S3* probably null Het
Asxl3 T C 18: 22,656,211 (GRCm39) V1407A probably benign Het
Atg13 A T 2: 91,515,107 (GRCm39) probably null Het
Atm A T 9: 53,365,579 (GRCm39) probably benign Het
Birc6 T G 17: 74,916,322 (GRCm39) V1746G possibly damaging Het
Cbln1 G T 8: 88,198,741 (GRCm39) T43K probably benign Het
Cbx5 T C 15: 103,108,127 (GRCm39) T173A probably damaging Het
Cc2d2a A G 5: 43,894,854 (GRCm39) Y1437C probably damaging Het
Ccdc78 C A 17: 26,008,210 (GRCm39) probably benign Het
Cd2bp2 A G 7: 126,793,000 (GRCm39) Y341H probably damaging Het
Cdhr5 T A 7: 140,856,291 (GRCm39) D88V probably damaging Het
Ces1f T A 8: 93,993,957 (GRCm39) T275S probably null Het
Cimip4 T A 15: 78,263,028 (GRCm39) M209L probably damaging Het
Clca4a T C 3: 144,666,478 (GRCm39) N458S probably benign Het
Cog5 A G 12: 31,889,840 (GRCm39) K521R probably damaging Het
Csf2ra T A 19: 61,214,006 (GRCm39) T305S probably benign Het
Csmd3 T A 15: 47,483,125 (GRCm39) probably benign Het
Cts6 T A 13: 61,349,313 (GRCm39) R132* probably null Het
D5Ertd579e G T 5: 36,773,809 (GRCm39) N195K probably damaging Het
Ddx1 A G 12: 13,273,809 (GRCm39) V606A probably damaging Het
Dip2b G A 15: 100,084,028 (GRCm39) D884N probably damaging Het
Ehhadh A G 16: 21,592,243 (GRCm39) probably null Het
Enpp1 T A 10: 24,529,815 (GRCm39) T608S probably benign Het
Fancm T C 12: 65,148,406 (GRCm39) Y674H probably damaging Het
Fat4 T A 3: 38,945,745 (GRCm39) V1546D probably damaging Het
Fsd1 G A 17: 56,297,522 (GRCm39) A158T probably benign Het
Fzd2 T A 11: 102,496,948 (GRCm39) M464K probably damaging Het
Gjc2 A G 11: 59,068,416 (GRCm39) F22S possibly damaging Het
Gria2 T C 3: 80,615,145 (GRCm39) Y445C probably damaging Het
Hsdl1 T A 8: 120,292,995 (GRCm39) I147F possibly damaging Het
Ifi44 T C 3: 151,451,273 (GRCm39) Y226C probably damaging Het
Il16 A G 7: 83,371,516 (GRCm39) C97R probably damaging Het
Impg1 A T 9: 80,252,843 (GRCm39) S369T probably damaging Het
Jmjd1c A G 10: 67,054,888 (GRCm39) T390A unknown Het
Lgi1 A G 19: 38,289,741 (GRCm39) E269G possibly damaging Het
Lrp6 G T 6: 134,427,860 (GRCm39) Y1577* probably null Het
Lrrc74a G T 12: 86,808,547 (GRCm39) probably benign Het
Man1c1 A T 4: 134,367,709 (GRCm39) probably null Het
Map1lc3b A C 8: 122,317,289 (GRCm39) Q9P possibly damaging Het
Mboat1 G A 13: 30,386,358 (GRCm39) R124H probably benign Het
Mcu A G 10: 59,292,499 (GRCm39) L60P probably damaging Het
Mrs2 G T 13: 25,202,517 (GRCm39) Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Neb G A 2: 52,096,890 (GRCm39) probably benign Het
Nlrp2 C T 7: 5,331,328 (GRCm39) G356D probably benign Het
Notch3 A G 17: 32,375,122 (GRCm39) probably benign Het
Npr2 A C 4: 43,641,617 (GRCm39) S474R probably damaging Het
Nup58 A G 14: 60,482,065 (GRCm39) F100L probably benign Het
Osbpl6 A C 2: 76,376,386 (GRCm39) D87A possibly damaging Het
Pabpc2 A T 18: 39,908,360 (GRCm39) M542L probably benign Het
Papln A G 12: 83,829,801 (GRCm39) probably benign Het
Parpbp T C 10: 87,928,758 (GRCm39) I561V possibly damaging Het
Pcdhb13 C T 18: 37,575,634 (GRCm39) A4V probably benign Het
Pelp1 T C 11: 70,286,530 (GRCm39) T533A possibly damaging Het
Poldip3 T A 15: 83,019,497 (GRCm39) M182L probably benign Het
Por T C 5: 135,760,032 (GRCm39) S240P possibly damaging Het
Pramel15 A T 4: 144,103,843 (GRCm39) probably benign Het
Pramel28 T C 4: 143,691,460 (GRCm39) E421G probably damaging Het
Prss22 A T 17: 24,215,275 (GRCm39) V167D probably damaging Het
Prss37 A C 6: 40,493,283 (GRCm39) L61R probably damaging Het
Psmd1 C T 1: 86,046,338 (GRCm39) T702M probably benign Het
Pxdn G T 12: 30,052,430 (GRCm39) G869V possibly damaging Het
Rabgap1l A G 1: 160,281,315 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,510,767 (GRCm39) V228A probably damaging Het
Rnf169 T C 7: 99,575,210 (GRCm39) R462G possibly damaging Het
Rnft2 A G 5: 118,332,745 (GRCm39) probably benign Het
Sgo2b T C 8: 64,379,670 (GRCm39) D1054G probably benign Het
Sh3bgr T C 16: 96,029,717 (GRCm39) probably benign Het
Slc12a4 A G 8: 106,671,982 (GRCm39) V910A possibly damaging Het
Slc6a12 A T 6: 121,332,331 (GRCm39) I222F probably benign Het
Spty2d1 G A 7: 46,647,649 (GRCm39) R427* probably null Het
Ssc5d A G 7: 4,947,662 (GRCm39) T1339A probably benign Het
Sspo A C 6: 48,432,686 (GRCm39) E854A possibly damaging Het
Stx7 A G 10: 24,060,977 (GRCm39) probably benign Het
Styk1 A T 6: 131,278,693 (GRCm39) probably benign Het
Tmem163 T G 1: 127,596,374 (GRCm39) probably benign Het
Tmppe C CT 9: 114,233,707 (GRCm39) probably null Het
Tmx2 A G 2: 84,503,426 (GRCm39) V229A probably benign Het
Top2b T C 14: 16,383,174 (GRCm38) L54P probably damaging Het
Trim62 A T 4: 128,796,343 (GRCm39) Y280F probably benign Het
Tssk4 A T 14: 55,889,016 (GRCm39) K181* probably null Het
Tssk4 A T 14: 55,889,017 (GRCm39) K181M probably damaging Het
Ubn1 A G 16: 4,882,478 (GRCm39) D313G probably damaging Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Ugt1a10 C T 1: 88,145,971 (GRCm39) P473L probably damaging Het
Other mutations in Adamdec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Adamdec1 APN 14 68,810,556 (GRCm39) missense probably damaging 1.00
IGL02026:Adamdec1 APN 14 68,809,251 (GRCm39) missense possibly damaging 0.81
IGL02068:Adamdec1 APN 14 68,814,558 (GRCm39) missense probably benign 0.21
IGL02416:Adamdec1 APN 14 68,810,282 (GRCm39) missense probably null 0.99
IGL02739:Adamdec1 APN 14 68,807,605 (GRCm39) nonsense probably null
IGL03078:Adamdec1 APN 14 68,806,299 (GRCm39) missense possibly damaging 0.53
IGL03115:Adamdec1 APN 14 68,808,802 (GRCm39) missense probably damaging 1.00
R0243:Adamdec1 UTSW 14 68,819,407 (GRCm39) critical splice donor site probably null
R0244:Adamdec1 UTSW 14 68,806,172 (GRCm39) nonsense probably null
R0416:Adamdec1 UTSW 14 68,806,161 (GRCm39) missense possibly damaging 0.79
R1373:Adamdec1 UTSW 14 68,808,400 (GRCm39) missense probably damaging 1.00
R1856:Adamdec1 UTSW 14 68,808,397 (GRCm39) missense probably damaging 1.00
R2570:Adamdec1 UTSW 14 68,816,657 (GRCm39) missense probably damaging 0.98
R3684:Adamdec1 UTSW 14 68,819,447 (GRCm39) missense probably benign 0.04
R3755:Adamdec1 UTSW 14 68,814,587 (GRCm39) missense probably damaging 1.00
R4450:Adamdec1 UTSW 14 68,810,568 (GRCm39) missense probably benign 0.00
R4661:Adamdec1 UTSW 14 68,807,562 (GRCm39) missense probably damaging 1.00
R4672:Adamdec1 UTSW 14 68,815,353 (GRCm39) nonsense probably null
R4673:Adamdec1 UTSW 14 68,815,353 (GRCm39) nonsense probably null
R4902:Adamdec1 UTSW 14 68,809,215 (GRCm39) missense probably damaging 0.99
R5017:Adamdec1 UTSW 14 68,810,694 (GRCm39) missense probably benign 0.01
R5018:Adamdec1 UTSW 14 68,809,228 (GRCm39) missense probably damaging 1.00
R5141:Adamdec1 UTSW 14 68,810,577 (GRCm39) missense probably benign 0.00
R5329:Adamdec1 UTSW 14 68,807,612 (GRCm39) missense probably damaging 1.00
R5395:Adamdec1 UTSW 14 68,808,352 (GRCm39) missense probably benign 0.04
R5864:Adamdec1 UTSW 14 68,807,551 (GRCm39) missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68,816,633 (GRCm39) missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68,816,633 (GRCm39) missense probably damaging 1.00
R6114:Adamdec1 UTSW 14 68,809,252 (GRCm39) missense probably benign 0.00
R6633:Adamdec1 UTSW 14 68,810,601 (GRCm39) missense probably benign 0.03
R7243:Adamdec1 UTSW 14 68,809,203 (GRCm39) missense probably benign 0.06
R7580:Adamdec1 UTSW 14 68,802,980 (GRCm39) missense probably benign 0.00
R8388:Adamdec1 UTSW 14 68,810,684 (GRCm39) nonsense probably null
R9133:Adamdec1 UTSW 14 68,814,547 (GRCm39) nonsense probably null
X0025:Adamdec1 UTSW 14 68,807,607 (GRCm39) missense probably damaging 1.00
X0050:Adamdec1 UTSW 14 68,807,607 (GRCm39) missense probably damaging 1.00
X0062:Adamdec1 UTSW 14 68,810,701 (GRCm39) missense probably benign 0.12
Z1177:Adamdec1 UTSW 14 68,818,092 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAAGGACTGACCATTTTGGGAC -3'
(R):5'- CTTAATGAGCCTCCCCACAGATGC -3'

Sequencing Primer
(F):5'- TCACAAGCAGCCTTGATTAATGAC -3'
(R):5'- GAACAGTCTCAGGATTTCAGTGC -3'
Posted On 2013-04-16