Incidental Mutation 'R0973:Mtor'
ID236722
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 039102-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0973 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148550188 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 2422 (V2422D)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect probably damaging
Transcript: ENSMUST00000103221
AA Change: V2422D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: V2422D

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129715
Meta Mutation Damage Score 0.9750 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 93% (38/41)
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930503L19Rik T A 18: 70,467,926 probably null Het
5430419D17Rik T C 7: 131,238,182 L611P probably damaging Het
Adam18 T C 8: 24,647,853 T324A probably benign Het
Adamts20 T A 15: 94,286,371 Q1517L probably benign Het
AI429214 A G 8: 36,994,319 Q207R probably benign Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Atad2b A G 12: 5,031,784 N1231S probably benign Het
Atp13a1 T C 8: 69,802,144 probably null Het
Atp6v0a1 T A 11: 101,055,491 L770* probably null Het
Atp8b3 T C 10: 80,534,198 N127S probably damaging Het
B3gnt5 T A 16: 19,770,010 D326E probably damaging Het
Birc6 T A 17: 74,565,861 S372T probably damaging Het
Btbd9 T A 17: 30,299,633 D451V probably damaging Het
Cd46 T C 1: 195,041,992 *366W probably null Het
Cdh18 T A 15: 23,473,995 D650E probably damaging Het
Cenpc1 A T 5: 86,037,908 V248E probably damaging Het
Cep152 A G 2: 125,594,899 S574P probably benign Het
Chd2 A G 7: 73,478,664 S858P probably damaging Het
Cib4 T C 5: 30,488,594 D110G probably damaging Het
Col9a2 T A 4: 121,039,788 probably null Het
Csmd2 A T 4: 128,496,188 I2239F possibly damaging Het
Csmd3 C A 15: 47,659,089 G2728V probably damaging Het
Cxcl1 A T 5: 90,891,767 K85* probably null Het
Cyp2d11 A G 15: 82,389,529 L416P possibly damaging Het
Daam1 A C 12: 71,915,784 K90T unknown Het
Depdc5 T A 5: 32,986,966 M1435K possibly damaging Het
Diexf A T 1: 193,114,703 N573K probably damaging Het
Dip2c G A 13: 9,576,908 A632T probably damaging Het
Dld A T 12: 31,334,054 I350N probably damaging Het
Dmtf1 T A 5: 9,127,987 I391F possibly damaging Het
Dnah14 T C 1: 181,752,145 V3081A probably damaging Het
Efemp1 A G 11: 28,854,538 E22G probably damaging Het
Ephb6 A G 6: 41,614,104 D65G probably damaging Het
Fsip2 A T 2: 82,977,092 T1252S probably benign Het
Gm13084 T C 4: 143,811,858 Y181C probably damaging Het
Gm4847 A G 1: 166,630,255 S510P probably benign Het
Golga4 T C 9: 118,537,273 I365T probably damaging Het
Gp2 A T 7: 119,454,543 L65Q probably damaging Het
Ibtk T C 9: 85,743,577 Y40C probably damaging Het
Ice1 C A 13: 70,602,427 V1847L probably benign Het
Ift172 C T 5: 31,265,355 R917H probably benign Het
Itgae C T 11: 73,138,509 Q1037* probably null Het
Kbtbd7 A G 14: 79,427,430 E234G possibly damaging Het
Khsrp T C 17: 57,025,576 T235A probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Lrfn5 G A 12: 61,843,437 G504D probably damaging Het
Macf1 A G 4: 123,476,000 V91A possibly damaging Het
Map6 G A 7: 99,336,743 G821D possibly damaging Het
Mark1 A C 1: 184,921,604 V167G probably damaging Het
Mrgprf T A 7: 145,308,256 L185Q probably damaging Het
Myh13 T A 11: 67,332,520 I222N probably damaging Het
Myh7b G A 2: 155,620,427 C350Y probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm3 C A 3: 115,101,986 S172R probably benign Het
Olfr1168 A T 2: 88,184,978 T34S probably benign Het
Olfr1231 A T 2: 89,303,184 I136N probably damaging Het
Olfr342 A G 2: 36,528,008 I199V probably benign Het
Olfr70 A G 4: 43,696,706 S156P probably damaging Het
Olfr912 T A 9: 38,581,283 V2D possibly damaging Het
Pacs1 A T 19: 5,143,829 D557E probably damaging Het
Pde1c A G 6: 56,361,815 F11L probably benign Het
Phactr2 T C 10: 13,247,139 D343G possibly damaging Het
Piezo2 T C 18: 63,015,802 Y2659C probably damaging Het
Pkd2l2 A G 18: 34,428,252 T438A probably damaging Het
Pld2 T C 11: 70,557,081 W857R probably damaging Het
Plxnb1 T C 9: 109,102,142 V410A possibly damaging Het
Ptger2 A G 14: 44,989,500 Y179C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rcan1 A T 16: 92,393,520 M177K probably benign Het
Rilpl1 A G 5: 124,501,871 S156P probably benign Het
Rilpl1 A G 5: 124,501,888 I122T possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpa1 C T 11: 75,312,973 probably null Het
Saxo2 A G 7: 82,634,870 V260A probably benign Het
Sel1l T C 12: 91,824,860 Y309C probably damaging Het
Setd1b GCCCCCCC GCCCCCCCCCCCCC 5: 123,160,703 probably benign Het
Slc33a1 A G 3: 63,943,304 F533S probably benign Het
Slc38a4 C T 15: 97,005,858 V421M probably benign Het
Snx14 A G 9: 88,400,721 probably null Het
Spef2 A G 15: 9,716,396 F368S probably damaging Het
Sri A T 5: 8,059,381 Q55L probably damaging Het
Stat4 A G 1: 52,096,820 I429M probably damaging Het
Stkld1 A T 2: 26,951,450 Q469L probably benign Het
Tm9sf1 T C 14: 55,642,935 T2A possibly damaging Het
Tmco5 A G 2: 116,883,218 T122A probably benign Het
Tmem59l G A 8: 70,486,060 P124S possibly damaging Het
Tmem81 G A 1: 132,507,924 R156Q probably damaging Het
Trpv6 T A 6: 41,625,188 T396S probably benign Het
Usp24 T A 4: 106,371,079 Y780* probably null Het
Vmn1r120 A G 7: 21,053,016 C257R probably damaging Het
Vmn2r53 A G 7: 12,601,392 F114L probably damaging Het
Vwf A G 6: 125,643,006 E1549G probably damaging Het
Zfp626 G A 7: 27,818,482 R296H probably damaging Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
Dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
R7423:Mtor UTSW 4 148556344 missense possibly damaging 0.77
R7434:Mtor UTSW 4 148464959 missense probably benign 0.39
R7619:Mtor UTSW 4 148462795 missense probably damaging 0.98
R7634:Mtor UTSW 4 148452350 missense possibly damaging 0.53
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTCTGTAGCAGGTCCCCAGTAC -3'
(R):5'- GCTCTGTAATTGTCAGGGACAC -3'

Sequencing Primer
(F):5'- GTCCCCAGTACTGTGTTAGAAATGAC -3'
(R):5'- TTGTCAGGGACACATACATACATAC -3'
Posted On2014-10-02