Incidental Mutation 'R0973:Vwf'
ID 236728
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms B130011O06Rik, 6820430P06Rik
MMRRC Submission 039102-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R0973 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 125529911-125663642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125619969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1549 (E1549G)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112254
AA Change: E1549G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: E1549G

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141521
Meta Mutation Damage Score 0.6347 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
Adamts20 T A 15: 94,184,252 (GRCm39) Q1517L probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Arhgef7 A G 8: 11,869,659 (GRCm39) T432A possibly damaging Het
Atad2b A G 12: 5,081,784 (GRCm39) N1231S probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
Atp8b3 T C 10: 80,370,032 (GRCm39) N127S probably damaging Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Birc6 T A 17: 74,872,856 (GRCm39) S372T probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cdh18 T A 15: 23,474,081 (GRCm39) D650E probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Cep152 A G 2: 125,436,819 (GRCm39) S574P probably benign Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cib4 T C 5: 30,645,938 (GRCm39) D110G probably damaging Het
Col9a2 T A 4: 120,896,985 (GRCm39) probably null Het
Csmd2 A T 4: 128,389,981 (GRCm39) I2239F possibly damaging Het
Csmd3 C A 15: 47,522,485 (GRCm39) G2728V probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Cyp2d11 A G 15: 82,273,730 (GRCm39) L416P possibly damaging Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Depdc5 T A 5: 33,144,310 (GRCm39) M1435K possibly damaging Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dld A T 12: 31,384,053 (GRCm39) I350N probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Gm4847 A G 1: 166,457,824 (GRCm39) S510P probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ibtk T C 9: 85,625,630 (GRCm39) Y40C probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Ift172 C T 5: 31,422,699 (GRCm39) R917H probably benign Het
Itgae C T 11: 73,029,335 (GRCm39) Q1037* probably null Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Macf1 A G 4: 123,369,793 (GRCm39) V91A possibly damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Mark1 A C 1: 184,653,801 (GRCm39) V167G probably damaging Het
Mrgprf T A 7: 144,861,993 (GRCm39) L185Q probably damaging Het
Mtor T A 4: 148,634,645 (GRCm39) V2422D probably damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Or8b48 T A 9: 38,492,579 (GRCm39) V2D possibly damaging Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Pde1c A G 6: 56,338,800 (GRCm39) F11L probably benign Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Piezo2 T C 18: 63,148,873 (GRCm39) Y2659C probably damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Plxnb1 T C 9: 108,931,210 (GRCm39) V410A possibly damaging Het
Pramel26 T C 4: 143,538,428 (GRCm39) Y181C probably damaging Het
Ptger2 A G 14: 45,226,957 (GRCm39) Y179C probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rcan1 A T 16: 92,190,408 (GRCm39) M177K probably benign Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Rpa1 C T 11: 75,203,799 (GRCm39) probably null Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Sel1l T C 12: 91,791,634 (GRCm39) Y309C probably damaging Het
Setd1b GCCCCCCC GCCCCCCCCCCCCC 5: 123,298,766 (GRCm39) probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Spef2 A G 15: 9,716,482 (GRCm39) F368S probably damaging Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Stat4 A G 1: 52,135,979 (GRCm39) I429M probably damaging Het
Stkld1 A T 2: 26,841,462 (GRCm39) Q469L probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Tmem81 G A 1: 132,435,662 (GRCm39) R156Q probably damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn1r120 A G 7: 20,786,941 (GRCm39) C257R probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125,635,835 (GRCm39) missense unknown
IGL00561:Vwf APN 6 125,619,684 (GRCm39) missense possibly damaging 0.88
IGL01104:Vwf APN 6 125,660,519 (GRCm39) missense probably damaging 1.00
IGL01404:Vwf APN 6 125,654,933 (GRCm39) missense probably damaging 1.00
IGL01539:Vwf APN 6 125,567,225 (GRCm39) missense possibly damaging 0.85
IGL01550:Vwf APN 6 125,656,252 (GRCm39) missense probably benign 0.00
IGL01563:Vwf APN 6 125,568,128 (GRCm39) missense probably damaging 1.00
IGL01637:Vwf APN 6 125,622,699 (GRCm39) missense probably damaging 1.00
IGL01720:Vwf APN 6 125,619,798 (GRCm39) missense possibly damaging 0.69
IGL01834:Vwf APN 6 125,567,133 (GRCm39) splice site probably benign
IGL02103:Vwf APN 6 125,623,318 (GRCm39) missense probably damaging 1.00
IGL02120:Vwf APN 6 125,592,997 (GRCm39) missense probably benign 0.26
IGL02174:Vwf APN 6 125,532,358 (GRCm39) missense probably damaging 1.00
IGL02203:Vwf APN 6 125,619,369 (GRCm39) missense probably damaging 1.00
IGL02420:Vwf APN 6 125,654,879 (GRCm39) missense probably benign 0.00
IGL02723:Vwf APN 6 125,619,893 (GRCm39) missense possibly damaging 0.85
IGL02818:Vwf APN 6 125,640,511 (GRCm39) missense probably benign
IGL02931:Vwf APN 6 125,592,931 (GRCm39) missense possibly damaging 0.68
IGL03015:Vwf APN 6 125,661,101 (GRCm39) splice site probably benign
IGL03038:Vwf APN 6 125,581,120 (GRCm39) missense possibly damaging 0.92
IGL03060:Vwf APN 6 125,640,523 (GRCm39) missense probably damaging 1.00
IGL03114:Vwf APN 6 125,576,326 (GRCm39) nonsense probably null
IGL03266:Vwf APN 6 125,655,040 (GRCm39) splice site probably benign
gingerman UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1628_Vwf_608 UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669_Vwf_448 UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R2130_vwf_946 UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
Russiahouse UTSW 6 125,616,304 (GRCm39) nonsense probably null
B5639:Vwf UTSW 6 125,619,947 (GRCm39) missense probably damaging 1.00
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0087:Vwf UTSW 6 125,622,917 (GRCm39) missense probably benign 0.03
R0194:Vwf UTSW 6 125,620,260 (GRCm39) missense probably benign
R0206:Vwf UTSW 6 125,614,419 (GRCm39) missense probably damaging 1.00
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0390:Vwf UTSW 6 125,603,324 (GRCm39) nonsense probably null
R0427:Vwf UTSW 6 125,650,902 (GRCm39) missense probably benign
R0437:Vwf UTSW 6 125,543,281 (GRCm39) missense probably damaging 1.00
R0470:Vwf UTSW 6 125,605,391 (GRCm39) missense possibly damaging 0.70
R0499:Vwf UTSW 6 125,615,077 (GRCm39) missense probably benign 0.10
R0554:Vwf UTSW 6 125,619,744 (GRCm39) missense probably benign 0.13
R0605:Vwf UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R0711:Vwf UTSW 6 125,603,234 (GRCm39) missense probably benign 0.01
R0723:Vwf UTSW 6 125,543,225 (GRCm39) missense probably benign 0.01
R1054:Vwf UTSW 6 125,567,190 (GRCm39) missense probably damaging 1.00
R1115:Vwf UTSW 6 125,632,028 (GRCm39) missense unknown
R1156:Vwf UTSW 6 125,614,451 (GRCm39) missense probably damaging 1.00
R1191:Vwf UTSW 6 125,576,215 (GRCm39) missense probably damaging 1.00
R1240:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
R1398:Vwf UTSW 6 125,580,420 (GRCm39) missense probably benign 0.02
R1435:Vwf UTSW 6 125,619,212 (GRCm39) nonsense probably null
R1528:Vwf UTSW 6 125,585,254 (GRCm39) missense possibly damaging 0.69
R1575:Vwf UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1575:Vwf UTSW 6 125,632,214 (GRCm39) missense unknown
R1628:Vwf UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669:Vwf UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1699:Vwf UTSW 6 125,662,863 (GRCm39) missense possibly damaging 0.74
R1699:Vwf UTSW 6 125,620,032 (GRCm39) missense probably damaging 1.00
R1725:Vwf UTSW 6 125,623,245 (GRCm39) missense probably benign 0.05
R1742:Vwf UTSW 6 125,644,513 (GRCm39) missense probably benign 0.02
R1809:Vwf UTSW 6 125,567,138 (GRCm39) splice site probably benign
R1833:Vwf UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R1866:Vwf UTSW 6 125,644,492 (GRCm39) missense possibly damaging 0.62
R1870:Vwf UTSW 6 125,619,902 (GRCm39) missense probably damaging 1.00
R1874:Vwf UTSW 6 125,605,335 (GRCm39) missense probably benign 0.00
R1941:Vwf UTSW 6 125,616,242 (GRCm39) missense possibly damaging 0.64
R2061:Vwf UTSW 6 125,568,151 (GRCm39) missense probably damaging 0.98
R2103:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2104:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2130:Vwf UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R2159:Vwf UTSW 6 125,603,304 (GRCm39) missense probably damaging 0.99
R2178:Vwf UTSW 6 125,619,095 (GRCm39) missense possibly damaging 0.90
R2656:Vwf UTSW 6 125,532,324 (GRCm39) missense probably benign 0.00
R2913:Vwf UTSW 6 125,662,809 (GRCm39) missense probably benign 0.08
R2917:Vwf UTSW 6 125,585,106 (GRCm39) missense probably benign 0.07
R3726:Vwf UTSW 6 125,654,911 (GRCm39) utr 3 prime probably benign
R3735:Vwf UTSW 6 125,565,576 (GRCm39) missense probably damaging 1.00
R3774:Vwf UTSW 6 125,626,062 (GRCm39) splice site probably null
R3934:Vwf UTSW 6 125,532,462 (GRCm39) missense probably damaging 1.00
R4291:Vwf UTSW 6 125,619,285 (GRCm39) missense probably damaging 1.00
R4384:Vwf UTSW 6 125,632,079 (GRCm39) missense unknown
R4743:Vwf UTSW 6 125,661,054 (GRCm39) critical splice acceptor site probably null
R4760:Vwf UTSW 6 125,547,567 (GRCm39) missense probably damaging 1.00
R4776:Vwf UTSW 6 125,543,268 (GRCm39) missense possibly damaging 0.53
R4791:Vwf UTSW 6 125,620,326 (GRCm39) missense
R4871:Vwf UTSW 6 125,663,425 (GRCm39) missense probably benign 0.25
R4894:Vwf UTSW 6 125,622,897 (GRCm39) nonsense probably null
R4963:Vwf UTSW 6 125,644,446 (GRCm39) nonsense probably null
R5010:Vwf UTSW 6 125,543,220 (GRCm39) missense probably benign 0.15
R5289:Vwf UTSW 6 125,644,473 (GRCm39) utr 3 prime probably benign
R5512:Vwf UTSW 6 125,650,850 (GRCm39) utr 3 prime probably benign
R5523:Vwf UTSW 6 125,620,005 (GRCm39) missense
R5642:Vwf UTSW 6 125,580,381 (GRCm39) missense
R5860:Vwf UTSW 6 125,656,228 (GRCm39) utr 3 prime probably benign
R5860:Vwf UTSW 6 125,620,053 (GRCm39) missense
R5896:Vwf UTSW 6 125,655,725 (GRCm39) critical splice acceptor site probably null
R5926:Vwf UTSW 6 125,581,137 (GRCm39) missense probably damaging 1.00
R5976:Vwf UTSW 6 125,580,426 (GRCm39) missense
R6053:Vwf UTSW 6 125,577,628 (GRCm39) missense probably benign 0.21
R6151:Vwf UTSW 6 125,634,028 (GRCm39) missense unknown
R6179:Vwf UTSW 6 125,626,252 (GRCm39) missense unknown
R6181:Vwf UTSW 6 125,543,109 (GRCm39) missense probably damaging 0.98
R6234:Vwf UTSW 6 125,634,128 (GRCm39) missense unknown
R6360:Vwf UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R6412:Vwf UTSW 6 125,656,279 (GRCm39) missense probably benign 0.00
R6464:Vwf UTSW 6 125,616,363 (GRCm39) critical splice donor site probably null
R6522:Vwf UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R6766:Vwf UTSW 6 125,616,339 (GRCm39) missense unknown
R6856:Vwf UTSW 6 125,619,113 (GRCm39) nonsense probably null
R6877:Vwf UTSW 6 125,634,164 (GRCm39) missense possibly damaging 0.48
R6896:Vwf UTSW 6 125,543,157 (GRCm39) missense probably damaging 1.00
R7113:Vwf UTSW 6 125,632,007 (GRCm39) missense
R7287:Vwf UTSW 6 125,614,430 (GRCm39) missense
R7359:Vwf UTSW 6 125,543,220 (GRCm39) missense
R7509:Vwf UTSW 6 125,619,132 (GRCm39) missense
R7519:Vwf UTSW 6 125,644,506 (GRCm39) missense
R7545:Vwf UTSW 6 125,591,060 (GRCm39) missense
R7549:Vwf UTSW 6 125,603,230 (GRCm39) missense
R7593:Vwf UTSW 6 125,624,731 (GRCm39) missense
R7635:Vwf UTSW 6 125,659,697 (GRCm39) missense
R7793:Vwf UTSW 6 125,663,483 (GRCm39) missense
R7802:Vwf UTSW 6 125,643,640 (GRCm39) missense
R7824:Vwf UTSW 6 125,635,778 (GRCm39) missense
R7849:Vwf UTSW 6 125,633,766 (GRCm39) missense
R7900:Vwf UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
R7919:Vwf UTSW 6 125,624,822 (GRCm39) missense
R7966:Vwf UTSW 6 125,616,304 (GRCm39) nonsense probably null
R8101:Vwf UTSW 6 125,547,522 (GRCm39) nonsense probably null
R8162:Vwf UTSW 6 125,622,799 (GRCm39) splice site probably null
R8345:Vwf UTSW 6 125,656,265 (GRCm39) missense
R8853:Vwf UTSW 6 125,634,227 (GRCm39) missense
R9027:Vwf UTSW 6 125,643,626 (GRCm39) missense
R9065:Vwf UTSW 6 125,623,262 (GRCm39) missense
R9068:Vwf UTSW 6 125,625,792 (GRCm39) unclassified probably benign
R9128:Vwf UTSW 6 125,619,693 (GRCm39) missense
R9136:Vwf UTSW 6 125,576,356 (GRCm39) splice site probably benign
R9164:Vwf UTSW 6 125,542,806 (GRCm39) missense
R9177:Vwf UTSW 6 125,581,254 (GRCm39) missense
R9334:Vwf UTSW 6 125,654,909 (GRCm39) missense
R9508:Vwf UTSW 6 125,532,471 (GRCm39) missense
R9553:Vwf UTSW 6 125,577,662 (GRCm39) missense
R9660:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9706:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9708:Vwf UTSW 6 125,634,053 (GRCm39) missense
R9712:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9714:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9728:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9758:Vwf UTSW 6 125,603,230 (GRCm39) missense
X0021:Vwf UTSW 6 125,623,294 (GRCm39) missense probably damaging 1.00
X0065:Vwf UTSW 6 125,580,396 (GRCm39) missense probably null 0.05
Z1176:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
Z1176:Vwf UTSW 6 125,568,194 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AACTCAGCCTCCACAGGTAG -3'
(R):5'- CATGTAGACCAGGTTAGGTGCC -3'

Sequencing Primer
(F):5'- ATCGCTGGGATCTCGTCAC -3'
(R):5'- TAGACCAGGTTAGGTGCCTCTAC -3'
Posted On 2014-10-02