Incidental Mutation 'R0973:Ptpro'
ID236729
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission 039102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0973 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137443594 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1007 (V1007D)
Ref Sequence ENSEMBL: ENSMUSP00000127112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: V1035D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V1035D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167002
AA Change: V214D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: V214D

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: V1007D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V1007D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203914
AA Change: V186D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: V186D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930503L19Rik T A 18: 70,467,926 probably null Het
5430419D17Rik T C 7: 131,238,182 L611P probably damaging Het
Adam18 T C 8: 24,647,853 T324A probably benign Het
Adamts20 T A 15: 94,286,371 Q1517L probably benign Het
AI429214 A G 8: 36,994,319 Q207R probably benign Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Atad2b A G 12: 5,031,784 N1231S probably benign Het
Atp13a1 T C 8: 69,802,144 probably null Het
Atp6v0a1 T A 11: 101,055,491 L770* probably null Het
Atp8b3 T C 10: 80,534,198 N127S probably damaging Het
B3gnt5 T A 16: 19,770,010 D326E probably damaging Het
Birc6 T A 17: 74,565,861 S372T probably damaging Het
Btbd9 T A 17: 30,299,633 D451V probably damaging Het
Cd46 T C 1: 195,041,992 *366W probably null Het
Cdh18 T A 15: 23,473,995 D650E probably damaging Het
Cenpc1 A T 5: 86,037,908 V248E probably damaging Het
Cep152 A G 2: 125,594,899 S574P probably benign Het
Chd2 A G 7: 73,478,664 S858P probably damaging Het
Cib4 T C 5: 30,488,594 D110G probably damaging Het
Col9a2 T A 4: 121,039,788 probably null Het
Csmd2 A T 4: 128,496,188 I2239F possibly damaging Het
Csmd3 C A 15: 47,659,089 G2728V probably damaging Het
Cxcl1 A T 5: 90,891,767 K85* probably null Het
Cyp2d11 A G 15: 82,389,529 L416P possibly damaging Het
Daam1 A C 12: 71,915,784 K90T unknown Het
Depdc5 T A 5: 32,986,966 M1435K possibly damaging Het
Diexf A T 1: 193,114,703 N573K probably damaging Het
Dip2c G A 13: 9,576,908 A632T probably damaging Het
Dld A T 12: 31,334,054 I350N probably damaging Het
Dmtf1 T A 5: 9,127,987 I391F possibly damaging Het
Dnah14 T C 1: 181,752,145 V3081A probably damaging Het
Efemp1 A G 11: 28,854,538 E22G probably damaging Het
Ephb6 A G 6: 41,614,104 D65G probably damaging Het
Fsip2 A T 2: 82,977,092 T1252S probably benign Het
Gm13084 T C 4: 143,811,858 Y181C probably damaging Het
Gm4847 A G 1: 166,630,255 S510P probably benign Het
Golga4 T C 9: 118,537,273 I365T probably damaging Het
Gp2 A T 7: 119,454,543 L65Q probably damaging Het
Ibtk T C 9: 85,743,577 Y40C probably damaging Het
Ice1 C A 13: 70,602,427 V1847L probably benign Het
Ift172 C T 5: 31,265,355 R917H probably benign Het
Itgae C T 11: 73,138,509 Q1037* probably null Het
Kbtbd7 A G 14: 79,427,430 E234G possibly damaging Het
Khsrp T C 17: 57,025,576 T235A probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Lrfn5 G A 12: 61,843,437 G504D probably damaging Het
Macf1 A G 4: 123,476,000 V91A possibly damaging Het
Map6 G A 7: 99,336,743 G821D possibly damaging Het
Mark1 A C 1: 184,921,604 V167G probably damaging Het
Mrgprf T A 7: 145,308,256 L185Q probably damaging Het
Mtor T A 4: 148,550,188 V2422D probably damaging Het
Myh13 T A 11: 67,332,520 I222N probably damaging Het
Myh7b G A 2: 155,620,427 C350Y probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm3 C A 3: 115,101,986 S172R probably benign Het
Olfr1168 A T 2: 88,184,978 T34S probably benign Het
Olfr1231 A T 2: 89,303,184 I136N probably damaging Het
Olfr342 A G 2: 36,528,008 I199V probably benign Het
Olfr70 A G 4: 43,696,706 S156P probably damaging Het
Olfr912 T A 9: 38,581,283 V2D possibly damaging Het
Pacs1 A T 19: 5,143,829 D557E probably damaging Het
Pde1c A G 6: 56,361,815 F11L probably benign Het
Phactr2 T C 10: 13,247,139 D343G possibly damaging Het
Piezo2 T C 18: 63,015,802 Y2659C probably damaging Het
Pkd2l2 A G 18: 34,428,252 T438A probably damaging Het
Pld2 T C 11: 70,557,081 W857R probably damaging Het
Plxnb1 T C 9: 109,102,142 V410A possibly damaging Het
Ptger2 A G 14: 44,989,500 Y179C probably damaging Het
Rcan1 A T 16: 92,393,520 M177K probably benign Het
Rilpl1 A G 5: 124,501,871 S156P probably benign Het
Rilpl1 A G 5: 124,501,888 I122T possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpa1 C T 11: 75,312,973 probably null Het
Saxo2 A G 7: 82,634,870 V260A probably benign Het
Sel1l T C 12: 91,824,860 Y309C probably damaging Het
Setd1b GCCCCCCC GCCCCCCCCCCCCC 5: 123,160,703 probably benign Het
Slc33a1 A G 3: 63,943,304 F533S probably benign Het
Slc38a4 C T 15: 97,005,858 V421M probably benign Het
Snx14 A G 9: 88,400,721 probably null Het
Spef2 A G 15: 9,716,396 F368S probably damaging Het
Sri A T 5: 8,059,381 Q55L probably damaging Het
Stat4 A G 1: 52,096,820 I429M probably damaging Het
Stkld1 A T 2: 26,951,450 Q469L probably benign Het
Tm9sf1 T C 14: 55,642,935 T2A possibly damaging Het
Tmco5 A G 2: 116,883,218 T122A probably benign Het
Tmem59l G A 8: 70,486,060 P124S possibly damaging Het
Tmem81 G A 1: 132,507,924 R156Q probably damaging Het
Trpv6 T A 6: 41,625,188 T396S probably benign Het
Usp24 T A 4: 106,371,079 Y780* probably null Het
Vmn1r120 A G 7: 21,053,016 C257R probably damaging Het
Vmn2r53 A G 7: 12,601,392 F114L probably damaging Het
Vwf A G 6: 125,643,006 E1549G probably damaging Het
Zfp626 G A 7: 27,818,482 R296H probably damaging Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
brau UTSW 6 137454598 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
jester UTSW 6 137449917 missense probably damaging 1.00
mann UTSW 6 137411116 splice site probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
R7019:Ptpro UTSW 6 137380478 missense probably benign
R7218:Ptpro UTSW 6 137454598 missense probably damaging 1.00
R7236:Ptpro UTSW 6 137368337 missense probably damaging 1.00
R7299:Ptpro UTSW 6 137441144 critical splice donor site probably null
R7381:Ptpro UTSW 6 137399561 missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137382649 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAACGGCAGCTGTCCTCAC -3'
(R):5'- AGTCTGTGCTCATGACAGGG -3'

Sequencing Primer
(F):5'- TGTCCTCACAGGTGTAGAACG -3'
(R):5'- TGATGCAGCCCCATGAAG -3'
Posted On2014-10-02