Incidental Mutation 'R0973:Plxnb1'
ID 236738
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Name plexin B1
Synonyms 2900002G15Rik
MMRRC Submission 039102-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0973 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 108924457-108948985 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108931210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 410 (V410A)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]
AlphaFold Q8CJH3
Predicted Effect possibly damaging
Transcript: ENSMUST00000072093
AA Change: V410A

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: V410A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130366
SMART Domains Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131462
SMART Domains Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192117
Predicted Effect probably benign
Transcript: ENSMUST00000192988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194734
Meta Mutation Damage Score 0.2423 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 93% (38/41)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
Adamts20 T A 15: 94,184,252 (GRCm39) Q1517L probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Arhgef7 A G 8: 11,869,659 (GRCm39) T432A possibly damaging Het
Atad2b A G 12: 5,081,784 (GRCm39) N1231S probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
Atp8b3 T C 10: 80,370,032 (GRCm39) N127S probably damaging Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Birc6 T A 17: 74,872,856 (GRCm39) S372T probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cdh18 T A 15: 23,474,081 (GRCm39) D650E probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Cep152 A G 2: 125,436,819 (GRCm39) S574P probably benign Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cib4 T C 5: 30,645,938 (GRCm39) D110G probably damaging Het
Col9a2 T A 4: 120,896,985 (GRCm39) probably null Het
Csmd2 A T 4: 128,389,981 (GRCm39) I2239F possibly damaging Het
Csmd3 C A 15: 47,522,485 (GRCm39) G2728V probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Cyp2d11 A G 15: 82,273,730 (GRCm39) L416P possibly damaging Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Depdc5 T A 5: 33,144,310 (GRCm39) M1435K possibly damaging Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dld A T 12: 31,384,053 (GRCm39) I350N probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Gm4847 A G 1: 166,457,824 (GRCm39) S510P probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ibtk T C 9: 85,625,630 (GRCm39) Y40C probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Ift172 C T 5: 31,422,699 (GRCm39) R917H probably benign Het
Itgae C T 11: 73,029,335 (GRCm39) Q1037* probably null Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Macf1 A G 4: 123,369,793 (GRCm39) V91A possibly damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Mark1 A C 1: 184,653,801 (GRCm39) V167G probably damaging Het
Mrgprf T A 7: 144,861,993 (GRCm39) L185Q probably damaging Het
Mtor T A 4: 148,634,645 (GRCm39) V2422D probably damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Or8b48 T A 9: 38,492,579 (GRCm39) V2D possibly damaging Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Pde1c A G 6: 56,338,800 (GRCm39) F11L probably benign Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Piezo2 T C 18: 63,148,873 (GRCm39) Y2659C probably damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Pramel26 T C 4: 143,538,428 (GRCm39) Y181C probably damaging Het
Ptger2 A G 14: 45,226,957 (GRCm39) Y179C probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rcan1 A T 16: 92,190,408 (GRCm39) M177K probably benign Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Rpa1 C T 11: 75,203,799 (GRCm39) probably null Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Sel1l T C 12: 91,791,634 (GRCm39) Y309C probably damaging Het
Setd1b GCCCCCCC GCCCCCCCCCCCCC 5: 123,298,766 (GRCm39) probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Spef2 A G 15: 9,716,482 (GRCm39) F368S probably damaging Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Stat4 A G 1: 52,135,979 (GRCm39) I429M probably damaging Het
Stkld1 A T 2: 26,841,462 (GRCm39) Q469L probably benign Het
Tm9sf1 T C 14: 55,880,392 (GRCm39) T2A possibly damaging Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Tmem81 G A 1: 132,435,662 (GRCm39) R156Q probably damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn1r120 A G 7: 20,786,941 (GRCm39) C257R probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Vwf A G 6: 125,619,969 (GRCm39) E1549G probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 108,942,936 (GRCm39) missense probably benign 0.04
IGL01014:Plxnb1 APN 9 108,935,102 (GRCm39) missense probably benign 0.00
IGL01142:Plxnb1 APN 9 108,931,765 (GRCm39) missense probably benign 0.05
IGL01454:Plxnb1 APN 9 108,942,422 (GRCm39) missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 108,934,483 (GRCm39) intron probably benign
IGL01530:Plxnb1 APN 9 108,939,473 (GRCm39) missense probably benign 0.02
IGL01599:Plxnb1 APN 9 108,939,672 (GRCm39) missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 108,930,052 (GRCm39) missense probably benign 0.00
IGL02175:Plxnb1 APN 9 108,929,914 (GRCm39) missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 108,929,918 (GRCm39) missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 108,941,201 (GRCm39) missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 108,930,190 (GRCm39) missense probably benign
IGL02645:Plxnb1 APN 9 108,943,311 (GRCm39) splice site probably benign
IGL03076:Plxnb1 APN 9 108,935,970 (GRCm39) missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 108,934,054 (GRCm39) missense probably benign
IGL03343:Plxnb1 APN 9 108,943,780 (GRCm39) missense probably damaging 1.00
PIT4431001:Plxnb1 UTSW 9 108,929,786 (GRCm39) missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 108,934,286 (GRCm39) missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 108,932,731 (GRCm39) nonsense probably null
R0211:Plxnb1 UTSW 9 108,932,731 (GRCm39) nonsense probably null
R0843:Plxnb1 UTSW 9 108,942,769 (GRCm39) missense probably benign 0.20
R0970:Plxnb1 UTSW 9 108,932,331 (GRCm39) missense probably damaging 1.00
R1342:Plxnb1 UTSW 9 108,929,720 (GRCm39) missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 108,930,091 (GRCm39) missense probably benign 0.27
R1419:Plxnb1 UTSW 9 108,943,454 (GRCm39) missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 108,937,989 (GRCm39) missense probably null
R1548:Plxnb1 UTSW 9 108,929,968 (GRCm39) missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 108,935,873 (GRCm39) missense probably benign 0.04
R1658:Plxnb1 UTSW 9 108,931,939 (GRCm39) nonsense probably null
R1727:Plxnb1 UTSW 9 108,930,125 (GRCm39) splice site probably null
R1750:Plxnb1 UTSW 9 108,940,836 (GRCm39) missense probably benign 0.00
R1795:Plxnb1 UTSW 9 108,929,813 (GRCm39) missense probably benign
R1929:Plxnb1 UTSW 9 108,931,776 (GRCm39) splice site probably null
R1935:Plxnb1 UTSW 9 108,924,715 (GRCm39) critical splice donor site probably null
R1936:Plxnb1 UTSW 9 108,924,715 (GRCm39) critical splice donor site probably null
R2014:Plxnb1 UTSW 9 108,935,687 (GRCm39) splice site probably benign
R2057:Plxnb1 UTSW 9 108,938,294 (GRCm39) missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 108,944,810 (GRCm39) missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 108,931,776 (GRCm39) splice site probably null
R2422:Plxnb1 UTSW 9 108,937,506 (GRCm39) missense probably benign 0.02
R2881:Plxnb1 UTSW 9 108,943,480 (GRCm39) missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 108,935,681 (GRCm39) splice site probably null
R3417:Plxnb1 UTSW 9 108,929,828 (GRCm39) missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 108,942,526 (GRCm39) unclassified probably benign
R3788:Plxnb1 UTSW 9 108,938,355 (GRCm39) missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 108,938,355 (GRCm39) missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 108,934,241 (GRCm39) missense probably benign 0.00
R4289:Plxnb1 UTSW 9 108,943,420 (GRCm39) missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 108,929,291 (GRCm39) missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 108,942,488 (GRCm39) missense probably benign 0.10
R4676:Plxnb1 UTSW 9 108,939,503 (GRCm39) missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 108,941,096 (GRCm39) missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 108,939,716 (GRCm39) missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 108,943,663 (GRCm39) missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 108,934,442 (GRCm39) missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 108,934,027 (GRCm39) missense probably benign 0.01
R4952:Plxnb1 UTSW 9 108,943,904 (GRCm39) missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 108,935,647 (GRCm39) missense probably benign 0.00
R5015:Plxnb1 UTSW 9 108,929,498 (GRCm39) missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 108,943,723 (GRCm39) missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 108,940,761 (GRCm39) splice site probably null
R5256:Plxnb1 UTSW 9 108,943,661 (GRCm39) missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 108,937,527 (GRCm39) missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 108,929,840 (GRCm39) missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 108,935,521 (GRCm39) missense probably benign 0.22
R5546:Plxnb1 UTSW 9 108,929,818 (GRCm39) missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 108,935,518 (GRCm39) missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 108,940,775 (GRCm39) missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 108,945,679 (GRCm39) missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 108,940,775 (GRCm39) missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 108,931,993 (GRCm39) splice site probably null
R6193:Plxnb1 UTSW 9 108,933,971 (GRCm39) missense probably benign
R6274:Plxnb1 UTSW 9 108,941,209 (GRCm39) critical splice donor site probably null
R6310:Plxnb1 UTSW 9 108,938,796 (GRCm39) missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 108,945,705 (GRCm39) missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 108,937,992 (GRCm39) missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 108,940,733 (GRCm39) missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 108,937,473 (GRCm39) critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 108,937,895 (GRCm39) missense probably benign
R6648:Plxnb1 UTSW 9 108,933,398 (GRCm39) missense probably benign 0.14
R6661:Plxnb1 UTSW 9 108,933,367 (GRCm39) missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 108,937,214 (GRCm39) missense probably benign 0.00
R6734:Plxnb1 UTSW 9 108,937,988 (GRCm39) nonsense probably null
R6859:Plxnb1 UTSW 9 108,935,838 (GRCm39) missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 108,945,702 (GRCm39) missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 108,941,375 (GRCm39) missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 108,929,453 (GRCm39) missense probably damaging 1.00
R7204:Plxnb1 UTSW 9 108,929,243 (GRCm39) missense probably damaging 1.00
R7427:Plxnb1 UTSW 9 108,937,236 (GRCm39) missense probably benign 0.01
R7428:Plxnb1 UTSW 9 108,937,236 (GRCm39) missense probably benign 0.01
R7443:Plxnb1 UTSW 9 108,943,675 (GRCm39) missense probably damaging 1.00
R7527:Plxnb1 UTSW 9 108,929,929 (GRCm39) missense probably damaging 0.99
R7645:Plxnb1 UTSW 9 108,943,480 (GRCm39) missense probably damaging 1.00
R7680:Plxnb1 UTSW 9 108,929,571 (GRCm39) nonsense probably null
R7866:Plxnb1 UTSW 9 108,929,525 (GRCm39) missense probably damaging 0.98
R7898:Plxnb1 UTSW 9 108,943,408 (GRCm39) missense probably damaging 1.00
R7905:Plxnb1 UTSW 9 108,938,300 (GRCm39) missense probably damaging 1.00
R8092:Plxnb1 UTSW 9 108,929,573 (GRCm39) missense probably damaging 1.00
R8150:Plxnb1 UTSW 9 108,941,146 (GRCm39) missense probably damaging 0.98
R8286:Plxnb1 UTSW 9 108,935,870 (GRCm39) missense probably damaging 1.00
R8290:Plxnb1 UTSW 9 108,938,687 (GRCm39) missense probably benign 0.00
R8987:Plxnb1 UTSW 9 108,937,178 (GRCm39) splice site probably benign
R9176:Plxnb1 UTSW 9 108,941,651 (GRCm39) missense probably damaging 1.00
R9231:Plxnb1 UTSW 9 108,934,286 (GRCm39) missense possibly damaging 0.59
R9698:Plxnb1 UTSW 9 108,925,251 (GRCm39) start gained probably benign
Z1177:Plxnb1 UTSW 9 108,937,989 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GAGATTATCCAGGCAGGGTC -3'
(R):5'- TGAAAGACCACAAGGCCTGG -3'

Sequencing Primer
(F):5'- ATTATCCAGGCAGGGTCTCAGTG -3'
(R):5'- AGCCTGGTCTAGATGAATCCCAG -3'
Posted On 2014-10-02