Incidental Mutation 'R0201:Poldip3'
ID 23675
Institutional Source Beutler Lab
Gene Symbol Poldip3
Ensembl Gene ENSMUSG00000041815
Gene Name polymerase (DNA-directed), delta interacting protein 3
Synonyms 1110008P04Rik, PDIP46
MMRRC Submission 038458-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R0201 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 83010177-83033585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83019497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 182 (M182L)
Ref Sequence ENSEMBL: ENSMUSP00000097944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058793] [ENSMUST00000100375] [ENSMUST00000129372]
AlphaFold Q8BG81
Predicted Effect probably benign
Transcript: ENSMUST00000058793
AA Change: M211L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054548
Gene: ENSMUSG00000041815
AA Change: M211L

DomainStartEndE-ValueType
low complexity region 183 196 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
RRM 281 347 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100375
AA Change: M182L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097944
Gene: ENSMUSG00000041815
AA Change: M182L

DomainStartEndE-ValueType
low complexity region 154 167 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
RRM 252 318 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129372
SMART Domains Protein: ENSMUSP00000120859
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 153 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150926
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RRM (RNA recognition motif)-containing protein that participates in the regulation of translation by recruiting ribosomal protein S6 kinase beta-1 to mRNAs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,819,406 (GRCm39) probably null Het
Adamts16 T A 13: 70,927,763 (GRCm39) Q492L possibly damaging Het
Aplnr A G 2: 84,967,521 (GRCm39) D182G probably damaging Het
Arnt2 G T 7: 84,010,867 (GRCm39) S3* probably null Het
Asxl3 T C 18: 22,656,211 (GRCm39) V1407A probably benign Het
Atg13 A T 2: 91,515,107 (GRCm39) probably null Het
Atm A T 9: 53,365,579 (GRCm39) probably benign Het
Birc6 T G 17: 74,916,322 (GRCm39) V1746G possibly damaging Het
Cbln1 G T 8: 88,198,741 (GRCm39) T43K probably benign Het
Cbx5 T C 15: 103,108,127 (GRCm39) T173A probably damaging Het
Cc2d2a A G 5: 43,894,854 (GRCm39) Y1437C probably damaging Het
Ccdc78 C A 17: 26,008,210 (GRCm39) probably benign Het
Cd2bp2 A G 7: 126,793,000 (GRCm39) Y341H probably damaging Het
Cdhr5 T A 7: 140,856,291 (GRCm39) D88V probably damaging Het
Ces1f T A 8: 93,993,957 (GRCm39) T275S probably null Het
Cimip4 T A 15: 78,263,028 (GRCm39) M209L probably damaging Het
Clca4a T C 3: 144,666,478 (GRCm39) N458S probably benign Het
Cog5 A G 12: 31,889,840 (GRCm39) K521R probably damaging Het
Csf2ra T A 19: 61,214,006 (GRCm39) T305S probably benign Het
Csmd3 T A 15: 47,483,125 (GRCm39) probably benign Het
Cts6 T A 13: 61,349,313 (GRCm39) R132* probably null Het
D5Ertd579e G T 5: 36,773,809 (GRCm39) N195K probably damaging Het
Ddx1 A G 12: 13,273,809 (GRCm39) V606A probably damaging Het
Dip2b G A 15: 100,084,028 (GRCm39) D884N probably damaging Het
Ehhadh A G 16: 21,592,243 (GRCm39) probably null Het
Enpp1 T A 10: 24,529,815 (GRCm39) T608S probably benign Het
Fancm T C 12: 65,148,406 (GRCm39) Y674H probably damaging Het
Fat4 T A 3: 38,945,745 (GRCm39) V1546D probably damaging Het
Fsd1 G A 17: 56,297,522 (GRCm39) A158T probably benign Het
Fzd2 T A 11: 102,496,948 (GRCm39) M464K probably damaging Het
Gjc2 A G 11: 59,068,416 (GRCm39) F22S possibly damaging Het
Gria2 T C 3: 80,615,145 (GRCm39) Y445C probably damaging Het
Hsdl1 T A 8: 120,292,995 (GRCm39) I147F possibly damaging Het
Ifi44 T C 3: 151,451,273 (GRCm39) Y226C probably damaging Het
Il16 A G 7: 83,371,516 (GRCm39) C97R probably damaging Het
Impg1 A T 9: 80,252,843 (GRCm39) S369T probably damaging Het
Jmjd1c A G 10: 67,054,888 (GRCm39) T390A unknown Het
Lgi1 A G 19: 38,289,741 (GRCm39) E269G possibly damaging Het
Lrp6 G T 6: 134,427,860 (GRCm39) Y1577* probably null Het
Lrrc74a G T 12: 86,808,547 (GRCm39) probably benign Het
Man1c1 A T 4: 134,367,709 (GRCm39) probably null Het
Map1lc3b A C 8: 122,317,289 (GRCm39) Q9P possibly damaging Het
Mboat1 G A 13: 30,386,358 (GRCm39) R124H probably benign Het
Mcu A G 10: 59,292,499 (GRCm39) L60P probably damaging Het
Mrs2 G T 13: 25,202,517 (GRCm39) Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Neb G A 2: 52,096,890 (GRCm39) probably benign Het
Nlrp2 C T 7: 5,331,328 (GRCm39) G356D probably benign Het
Notch3 A G 17: 32,375,122 (GRCm39) probably benign Het
Npr2 A C 4: 43,641,617 (GRCm39) S474R probably damaging Het
Nup58 A G 14: 60,482,065 (GRCm39) F100L probably benign Het
Osbpl6 A C 2: 76,376,386 (GRCm39) D87A possibly damaging Het
Pabpc2 A T 18: 39,908,360 (GRCm39) M542L probably benign Het
Papln A G 12: 83,829,801 (GRCm39) probably benign Het
Parpbp T C 10: 87,928,758 (GRCm39) I561V possibly damaging Het
Pcdhb13 C T 18: 37,575,634 (GRCm39) A4V probably benign Het
Pelp1 T C 11: 70,286,530 (GRCm39) T533A possibly damaging Het
Por T C 5: 135,760,032 (GRCm39) S240P possibly damaging Het
Pramel15 A T 4: 144,103,843 (GRCm39) probably benign Het
Pramel28 T C 4: 143,691,460 (GRCm39) E421G probably damaging Het
Prss22 A T 17: 24,215,275 (GRCm39) V167D probably damaging Het
Prss37 A C 6: 40,493,283 (GRCm39) L61R probably damaging Het
Psmd1 C T 1: 86,046,338 (GRCm39) T702M probably benign Het
Pxdn G T 12: 30,052,430 (GRCm39) G869V possibly damaging Het
Rabgap1l A G 1: 160,281,315 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,510,767 (GRCm39) V228A probably damaging Het
Rnf169 T C 7: 99,575,210 (GRCm39) R462G possibly damaging Het
Rnft2 A G 5: 118,332,745 (GRCm39) probably benign Het
Sgo2b T C 8: 64,379,670 (GRCm39) D1054G probably benign Het
Sh3bgr T C 16: 96,029,717 (GRCm39) probably benign Het
Slc12a4 A G 8: 106,671,982 (GRCm39) V910A possibly damaging Het
Slc6a12 A T 6: 121,332,331 (GRCm39) I222F probably benign Het
Spty2d1 G A 7: 46,647,649 (GRCm39) R427* probably null Het
Ssc5d A G 7: 4,947,662 (GRCm39) T1339A probably benign Het
Sspo A C 6: 48,432,686 (GRCm39) E854A possibly damaging Het
Stx7 A G 10: 24,060,977 (GRCm39) probably benign Het
Styk1 A T 6: 131,278,693 (GRCm39) probably benign Het
Tmem163 T G 1: 127,596,374 (GRCm39) probably benign Het
Tmppe C CT 9: 114,233,707 (GRCm39) probably null Het
Tmx2 A G 2: 84,503,426 (GRCm39) V229A probably benign Het
Top2b T C 14: 16,383,174 (GRCm38) L54P probably damaging Het
Trim62 A T 4: 128,796,343 (GRCm39) Y280F probably benign Het
Tssk4 A T 14: 55,889,016 (GRCm39) K181* probably null Het
Tssk4 A T 14: 55,889,017 (GRCm39) K181M probably damaging Het
Ubn1 A G 16: 4,882,478 (GRCm39) D313G probably damaging Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Ugt1a10 C T 1: 88,145,971 (GRCm39) P473L probably damaging Het
Other mutations in Poldip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Poldip3 APN 15 83,022,680 (GRCm39) missense probably damaging 1.00
IGL02887:Poldip3 APN 15 83,013,469 (GRCm39) unclassified probably benign
R0143:Poldip3 UTSW 15 83,012,144 (GRCm39) missense probably damaging 1.00
R0511:Poldip3 UTSW 15 83,022,436 (GRCm39) missense probably damaging 1.00
R1560:Poldip3 UTSW 15 83,022,527 (GRCm39) missense probably damaging 1.00
R2302:Poldip3 UTSW 15 83,013,469 (GRCm39) unclassified probably benign
R3755:Poldip3 UTSW 15 83,015,676 (GRCm39) unclassified probably benign
R3756:Poldip3 UTSW 15 83,015,676 (GRCm39) unclassified probably benign
R4785:Poldip3 UTSW 15 83,015,702 (GRCm39) missense probably damaging 1.00
R4917:Poldip3 UTSW 15 83,016,776 (GRCm39) critical splice donor site probably null
R4965:Poldip3 UTSW 15 83,021,706 (GRCm39) missense possibly damaging 0.80
R5009:Poldip3 UTSW 15 83,017,395 (GRCm39) missense probably damaging 1.00
R5030:Poldip3 UTSW 15 83,022,392 (GRCm39) missense possibly damaging 0.67
R5992:Poldip3 UTSW 15 83,013,430 (GRCm39) missense probably damaging 0.96
R6638:Poldip3 UTSW 15 83,017,401 (GRCm39) missense probably damaging 1.00
R7028:Poldip3 UTSW 15 83,015,698 (GRCm39) missense probably damaging 1.00
R9377:Poldip3 UTSW 15 83,019,589 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGACCTTGACACCCCAGTATTAGC -3'
(R):5'- TGAAGCCTTTGGTCACACGTCTC -3'

Sequencing Primer
(F):5'- CACCCCAGTATTAGCAATGTTAAATC -3'
(R):5'- GGTCACACGTCTCTCGAC -3'
Posted On 2013-04-16