Mutagenetix > Incidental Mutation

Incidental Mutation 'R0973:Birc6'

236754

Institutional Source

Beutler Lab

Gene Symbol

Birc6

Ensembl Gene

ENSMUSG00000024073

Gene Name

baculoviral IAP repeat-containing 6

Synonyms

D630005A10Rik, apollon, Bruce, A430032G04Rik, A430040A19Rik

MMRRC Submission

039102-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0973 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74528295-74703356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74565861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 372 (S372T)

Ref Sequence

ENSEMBL: ENSMUSP00000138333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182597] [ENSMUST00000182944] [ENSMUST00000183224]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000180037
AA Change: S372T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: S372T

Domain	Start	End	E-Value	Type
low complexity region	24	54	N/A	INTRINSIC
BIR	287	363	2.87e-24	SMART
low complexity region	472	493	N/A	INTRINSIC
low complexity region	624	635	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
low complexity region	769	781	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1369	1380	N/A	INTRINSIC
coiled coil region	1620	1675	N/A	INTRINSIC
low complexity region	1709	1726	N/A	INTRINSIC
low complexity region	1993	1998	N/A	INTRINSIC
low complexity region	2044	2059	N/A	INTRINSIC
low complexity region	2142	2163	N/A	INTRINSIC
low complexity region	2253	2266	N/A	INTRINSIC
low complexity region	2491	2505	N/A	INTRINSIC
low complexity region	2671	2688	N/A	INTRINSIC
low complexity region	2893	2905	N/A	INTRINSIC
low complexity region	2958	2970	N/A	INTRINSIC
Pfam:DUF3643	3477	3632	1e-69	PFAM
low complexity region	3747	3772	N/A	INTRINSIC
low complexity region	3900	3919	N/A	INTRINSIC
low complexity region	3940	3958	N/A	INTRINSIC
low complexity region	3963	3972	N/A	INTRINSIC
low complexity region	4146	4157	N/A	INTRINSIC
low complexity region	4307	4318	N/A	INTRINSIC
low complexity region	4433	4444	N/A	INTRINSIC
UBCc	4592	4756	1.04e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182108

Predicted Effect

probably damaging
Transcript: ENSMUST00000182133
AA Change: S372T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: S372T

Domain	Start	End	E-Value	Type
low complexity region	24	54	N/A	INTRINSIC
BIR	287	363	2.87e-24	SMART
low complexity region	472	493	N/A	INTRINSIC
low complexity region	624	635	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
low complexity region	769	781	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1369	1380	N/A	INTRINSIC
coiled coil region	1620	1675	N/A	INTRINSIC
low complexity region	1709	1726	N/A	INTRINSIC
low complexity region	1993	1998	N/A	INTRINSIC
low complexity region	2044	2055	N/A	INTRINSIC
low complexity region	2136	2157	N/A	INTRINSIC
low complexity region	2247	2260	N/A	INTRINSIC
low complexity region	2485	2499	N/A	INTRINSIC
low complexity region	2665	2682	N/A	INTRINSIC
low complexity region	2887	2899	N/A	INTRINSIC
low complexity region	2952	2964	N/A	INTRINSIC
Pfam:DUF3643	3470	3626	2.1e-71	PFAM
low complexity region	3741	3766	N/A	INTRINSIC
low complexity region	3894	3913	N/A	INTRINSIC
low complexity region	3934	3952	N/A	INTRINSIC
low complexity region	3957	3966	N/A	INTRINSIC
low complexity region	4140	4151	N/A	INTRINSIC
low complexity region	4301	4312	N/A	INTRINSIC
low complexity region	4427	4438	N/A	INTRINSIC
UBCc	4586	4750	1.04e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182257

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182362

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182382

Predicted Effect

probably damaging
Transcript: ENSMUST00000182597
AA Change: S372T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: S372T

Domain	Start	End	E-Value	Type
low complexity region	24	54	N/A	INTRINSIC
BIR	287	363	2.87e-24	SMART
low complexity region	472	493	N/A	INTRINSIC
low complexity region	624	635	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
low complexity region	769	781	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1369	1380	N/A	INTRINSIC
coiled coil region	1620	1675	N/A	INTRINSIC
low complexity region	1709	1726	N/A	INTRINSIC
low complexity region	1993	1998	N/A	INTRINSIC
low complexity region	2044	2059	N/A	INTRINSIC
low complexity region	2142	2163	N/A	INTRINSIC
low complexity region	2262	2275	N/A	INTRINSIC
low complexity region	2500	2514	N/A	INTRINSIC
low complexity region	2680	2697	N/A	INTRINSIC
low complexity region	2902	2914	N/A	INTRINSIC
low complexity region	2967	2979	N/A	INTRINSIC
Pfam:DUF3643	3485	3641	2.2e-71	PFAM
low complexity region	3756	3781	N/A	INTRINSIC
low complexity region	3909	3928	N/A	INTRINSIC
low complexity region	3949	3967	N/A	INTRINSIC
low complexity region	3972	3981	N/A	INTRINSIC
low complexity region	4155	4166	N/A	INTRINSIC
low complexity region	4316	4327	N/A	INTRINSIC
low complexity region	4442	4453	N/A	INTRINSIC
UBCc	4601	4765	1.04e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182944
AA Change: S372T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: S372T

Domain	Start	End	E-Value	Type
low complexity region	24	54	N/A	INTRINSIC
BIR	287	363	2.87e-24	SMART
low complexity region	472	493	N/A	INTRINSIC
low complexity region	624	635	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
low complexity region	769	781	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1369	1380	N/A	INTRINSIC
coiled coil region	1616	1671	N/A	INTRINSIC
low complexity region	1705	1722	N/A	INTRINSIC
low complexity region	1989	1994	N/A	INTRINSIC
low complexity region	2040	2055	N/A	INTRINSIC
low complexity region	2138	2159	N/A	INTRINSIC
low complexity region	2249	2262	N/A	INTRINSIC
low complexity region	2487	2501	N/A	INTRINSIC
low complexity region	2667	2684	N/A	INTRINSIC
low complexity region	2889	2901	N/A	INTRINSIC
low complexity region	2954	2966	N/A	INTRINSIC
Pfam:DUF3643	3472	3628	3.2e-71	PFAM
low complexity region	3743	3768	N/A	INTRINSIC
low complexity region	3896	3915	N/A	INTRINSIC
low complexity region	3936	3954	N/A	INTRINSIC
low complexity region	3959	3968	N/A	INTRINSIC
low complexity region	4142	4153	N/A	INTRINSIC
low complexity region	4303	4314	N/A	INTRINSIC
low complexity region	4429	4440	N/A	INTRINSIC
UBCc	4588	4752	1.04e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000183224
AA Change: S344T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: S344T

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
BIR	259	335	2.87e-24	SMART
low complexity region	444	465	N/A	INTRINSIC
low complexity region	596	607	N/A	INTRINSIC
low complexity region	646	657	N/A	INTRINSIC
low complexity region	741	753	N/A	INTRINSIC
low complexity region	1026	1043	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC
coiled coil region	1606	1661	N/A	INTRINSIC
low complexity region	1695	1712	N/A	INTRINSIC
low complexity region	1979	1984	N/A	INTRINSIC
low complexity region	2030	2041	N/A	INTRINSIC
low complexity region	2122	2143	N/A	INTRINSIC
low complexity region	2233	2246	N/A	INTRINSIC
low complexity region	2471	2485	N/A	INTRINSIC
low complexity region	2651	2668	N/A	INTRINSIC
low complexity region	2873	2885	N/A	INTRINSIC
low complexity region	2938	2950	N/A	INTRINSIC
Pfam:DUF3643	3456	3612	3.2e-71	PFAM
low complexity region	3727	3752	N/A	INTRINSIC
low complexity region	3880	3899	N/A	INTRINSIC
low complexity region	3920	3938	N/A	INTRINSIC
low complexity region	3943	3952	N/A	INTRINSIC
low complexity region	4126	4137	N/A	INTRINSIC
low complexity region	4287	4298	N/A	INTRINSIC
low complexity region	4413	4424	N/A	INTRINSIC
UBCc	4572	4736	1.04e-25	SMART

Meta Mutation Damage Score

0.4118

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

93% (38/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	C	T	1: 184,033,505	S119N	probably benign	Het
4930503L19Rik	T	A	18: 70,467,926		probably null	Het
5430419D17Rik	T	C	7: 131,238,182	L611P	probably damaging	Het
Adam18	T	C	8: 24,647,853	T324A	probably benign	Het
Adamts20	T	A	15: 94,286,371	Q1517L	probably benign	Het
AI429214	A	G	8: 36,994,319	Q207R	probably benign	Het
Arhgef7	A	G	8: 11,819,659	T432A	possibly damaging	Het
Atad2b	A	G	12: 5,031,784	N1231S	probably benign	Het
Atp13a1	T	C	8: 69,802,144		probably null	Het
Atp6v0a1	T	A	11: 101,055,491	L770*	probably null	Het
Atp8b3	T	C	10: 80,534,198	N127S	probably damaging	Het
B3gnt5	T	A	16: 19,770,010	D326E	probably damaging	Het
Btbd9	T	A	17: 30,299,633	D451V	probably damaging	Het
Cd46	T	C	1: 195,041,992	*366W	probably null	Het
Cdh18	T	A	15: 23,473,995	D650E	probably damaging	Het
Cenpc1	A	T	5: 86,037,908	V248E	probably damaging	Het
Cep152	A	G	2: 125,594,899	S574P	probably benign	Het
Chd2	A	G	7: 73,478,664	S858P	probably damaging	Het
Cib4	T	C	5: 30,488,594	D110G	probably damaging	Het
Col9a2	T	A	4: 121,039,788		probably null	Het
Csmd2	A	T	4: 128,496,188	I2239F	possibly damaging	Het
Csmd3	C	A	15: 47,659,089	G2728V	probably damaging	Het
Cxcl1	A	T	5: 90,891,767	K85*	probably null	Het
Cyp2d11	A	G	15: 82,389,529	L416P	possibly damaging	Het
Daam1	A	C	12: 71,915,784	K90T	unknown	Het
Depdc5	T	A	5: 32,986,966	M1435K	possibly damaging	Het
Diexf	A	T	1: 193,114,703	N573K	probably damaging	Het
Dip2c	G	A	13: 9,576,908	A632T	probably damaging	Het
Dld	A	T	12: 31,334,054	I350N	probably damaging	Het
Dmtf1	T	A	5: 9,127,987	I391F	possibly damaging	Het
Dnah14	T	C	1: 181,752,145	V3081A	probably damaging	Het
Efemp1	A	G	11: 28,854,538	E22G	probably damaging	Het
Ephb6	A	G	6: 41,614,104	D65G	probably damaging	Het
Fsip2	A	T	2: 82,977,092	T1252S	probably benign	Het
Gm13084	T	C	4: 143,811,858	Y181C	probably damaging	Het
Gm4847	A	G	1: 166,630,255	S510P	probably benign	Het
Golga4	T	C	9: 118,537,273	I365T	probably damaging	Het
Gp2	A	T	7: 119,454,543	L65Q	probably damaging	Het
Ibtk	T	C	9: 85,743,577	Y40C	probably damaging	Het
Ice1	C	A	13: 70,602,427	V1847L	probably benign	Het
Ift172	C	T	5: 31,265,355	R917H	probably benign	Het
Itgae	C	T	11: 73,138,509	Q1037*	probably null	Het
Kbtbd7	A	G	14: 79,427,430	E234G	possibly damaging	Het
Khsrp	T	C	17: 57,025,576	T235A	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Lrfn5	G	A	12: 61,843,437	G504D	probably damaging	Het
Macf1	A	G	4: 123,476,000	V91A	possibly damaging	Het
Map6	G	A	7: 99,336,743	G821D	possibly damaging	Het
Mark1	A	C	1: 184,921,604	V167G	probably damaging	Het
Mrgprf	T	A	7: 145,308,256	L185Q	probably damaging	Het
Mtor	T	A	4: 148,550,188	V2422D	probably damaging	Het
Myh13	T	A	11: 67,332,520	I222N	probably damaging	Het
Myh7b	G	A	2: 155,620,427	C350Y	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfm3	C	A	3: 115,101,986	S172R	probably benign	Het
Olfr1168	A	T	2: 88,184,978	T34S	probably benign	Het
Olfr1231	A	T	2: 89,303,184	I136N	probably damaging	Het
Olfr342	A	G	2: 36,528,008	I199V	probably benign	Het
Olfr70	A	G	4: 43,696,706	S156P	probably damaging	Het
Olfr912	T	A	9: 38,581,283	V2D	possibly damaging	Het
Pacs1	A	T	19: 5,143,829	D557E	probably damaging	Het
Pde1c	A	G	6: 56,361,815	F11L	probably benign	Het
Phactr2	T	C	10: 13,247,139	D343G	possibly damaging	Het
Piezo2	T	C	18: 63,015,802	Y2659C	probably damaging	Het
Pkd2l2	A	G	18: 34,428,252	T438A	probably damaging	Het
Pld2	T	C	11: 70,557,081	W857R	probably damaging	Het
Plxnb1	T	C	9: 109,102,142	V410A	possibly damaging	Het
Ptger2	A	G	14: 44,989,500	Y179C	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rcan1	A	T	16: 92,393,520	M177K	probably benign	Het
Rilpl1	A	G	5: 124,501,871	S156P	probably benign	Het
Rilpl1	A	G	5: 124,501,888	I122T	possibly damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Rpa1	C	T	11: 75,312,973		probably null	Het
Saxo2	A	G	7: 82,634,870	V260A	probably benign	Het
Sel1l	T	C	12: 91,824,860	Y309C	probably damaging	Het
Setd1b	GCCCCCCC	GCCCCCCCCCCCCC	5: 123,160,703		probably benign	Het
Slc33a1	A	G	3: 63,943,304	F533S	probably benign	Het
Slc38a4	C	T	15: 97,005,858	V421M	probably benign	Het
Snx14	A	G	9: 88,400,721		probably null	Het
Spef2	A	G	15: 9,716,396	F368S	probably damaging	Het
Sri	A	T	5: 8,059,381	Q55L	probably damaging	Het
Stat4	A	G	1: 52,096,820	I429M	probably damaging	Het
Stkld1	A	T	2: 26,951,450	Q469L	probably benign	Het
Tm9sf1	T	C	14: 55,642,935	T2A	possibly damaging	Het
Tmco5	A	G	2: 116,883,218	T122A	probably benign	Het
Tmem59l	G	A	8: 70,486,060	P124S	possibly damaging	Het
Tmem81	G	A	1: 132,507,924	R156Q	probably damaging	Het
Trpv6	T	A	6: 41,625,188	T396S	probably benign	Het
Usp24	T	A	4: 106,371,079	Y780*	probably null	Het
Vmn1r120	A	G	7: 21,053,016	C257R	probably damaging	Het
Vmn2r53	A	G	7: 12,601,392	F114L	probably damaging	Het
Vwf	A	G	6: 125,643,006	E1549G	probably damaging	Het
Zfp626	G	A	7: 27,818,482	R296H	probably damaging	Het

Other mutations in Birc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Birc6	APN	17	74573563	splice site	probably benign
IGL00542:Birc6	APN	17	74623771	splice site	probably null
IGL00659:Birc6	APN	17	74660653	missense	probably damaging	1.00
IGL00710:Birc6	APN	17	74609089	missense	probably benign	0.37
IGL00806:Birc6	APN	17	74611529	missense	possibly damaging	0.85
IGL00848:Birc6	APN	17	74696393	nonsense	probably null
IGL01071:Birc6	APN	17	74566132	missense	possibly damaging	0.84
IGL01071:Birc6	APN	17	74631701	missense	probably damaging	1.00
IGL01121:Birc6	APN	17	74631038	missense	probably benign	0.08
IGL01132:Birc6	APN	17	74603060	missense	probably damaging	1.00
IGL01323:Birc6	APN	17	74622925	missense	probably damaging	1.00
IGL01444:Birc6	APN	17	74631687	missense	probably damaging	1.00
IGL01511:Birc6	APN	17	74627003	nonsense	probably null
IGL01576:Birc6	APN	17	74677370	missense	possibly damaging	0.80
IGL01578:Birc6	APN	17	74648197	missense	probably benign	0.08
IGL01649:Birc6	APN	17	74604546	missense	probably benign	0.03
IGL01657:Birc6	APN	17	74660611	missense	probably damaging	1.00
IGL01739:Birc6	APN	17	74659221	missense	probably benign
IGL01756:Birc6	APN	17	74640208	missense	probably benign	0.00
IGL01807:Birc6	APN	17	74631037	missense	probably benign
IGL01885:Birc6	APN	17	74604516	missense	possibly damaging	0.51
IGL01906:Birc6	APN	17	74638358	missense	probably damaging	1.00
IGL01915:Birc6	APN	17	74631720	missense	probably benign	0.34
IGL01998:Birc6	APN	17	74579885	missense	probably benign	0.06
IGL02084:Birc6	APN	17	74608282	missense	probably benign	0.45
IGL02086:Birc6	APN	17	74639827	missense	probably damaging	1.00
IGL02161:Birc6	APN	17	74548837	missense	probably damaging	0.99
IGL02195:Birc6	APN	17	74697381	splice site	probably benign
IGL02283:Birc6	APN	17	74599940	missense	probably benign
IGL02476:Birc6	APN	17	74696391	missense	possibly damaging	0.81
IGL02493:Birc6	APN	17	74652059	unclassified	probably benign
IGL02547:Birc6	APN	17	74579645	missense	probably benign	0.21
IGL02678:Birc6	APN	17	74649903	missense	probably damaging	1.00
IGL02713:Birc6	APN	17	74579324	missense	probably benign
IGL02851:Birc6	APN	17	74609189	missense	probably damaging	1.00
IGL02875:Birc6	APN	17	74589718	missense	probably damaging	1.00
IGL02985:Birc6	APN	17	74640190	missense	probably benign	0.00
IGL03004:Birc6	APN	17	74612185	missense	probably benign	0.10
IGL03053:Birc6	APN	17	74565972	missense	probably damaging	1.00
IGL03085:Birc6	APN	17	74596950	missense	probably damaging	0.97
IGL03109:Birc6	APN	17	74579334	missense	possibly damaging	0.71
IGL03143:Birc6	APN	17	74598999	missense	possibly damaging	0.89
IGL03180:Birc6	APN	17	74659231	missense	probably benign
IGL03221:Birc6	APN	17	74627007	missense	probably benign	0.00
IGL03230:Birc6	APN	17	74611070	missense	probably damaging	1.00
IGL03294:Birc6	APN	17	74649886	missense	probably benign	0.02
IGL03399:Birc6	APN	17	74594373	missense	probably benign	0.01
Badlands	UTSW	17	74603036	missense	probably damaging	1.00
Big_sky	UTSW	17	74528538	missense	probably null	0.33
bitterroot	UTSW	17	74649696	missense	probably damaging	1.00
Black_hills	UTSW	17	74692332	missense	probably damaging	1.00
bottomlands	UTSW	17	74609659	missense	probably damaging	1.00
Chai	UTSW	17	74670374	missense	probably damaging	1.00
Dakota	UTSW	17	74625104	critical splice acceptor site	probably null
Sempervirens	UTSW	17	74642504	missense	probably damaging	1.00
E0370:Birc6	UTSW	17	74677357	missense	probably damaging	1.00
G1citation:Birc6	UTSW	17	74580382	missense	possibly damaging	0.82
G1citation:Birc6	UTSW	17	74598044	missense	probably damaging	1.00
PIT4494001:Birc6	UTSW	17	74626980	missense	probably damaging	1.00
R0081:Birc6	UTSW	17	74643441	missense	probably benign	0.01
R0086:Birc6	UTSW	17	74593166	missense	possibly damaging	0.54
R0089:Birc6	UTSW	17	74638376	missense	possibly damaging	0.90
R0116:Birc6	UTSW	17	74623746	splice site	probably benign
R0129:Birc6	UTSW	17	74528760	missense	probably benign	0.05
R0196:Birc6	UTSW	17	74580287	missense	possibly damaging	0.57
R0201:Birc6	UTSW	17	74609327	missense	possibly damaging	0.92
R0207:Birc6	UTSW	17	74662832	splice site	probably benign
R0295:Birc6	UTSW	17	74613362	intron	probably benign
R0386:Birc6	UTSW	17	74599340	missense	probably damaging	0.99
R0423:Birc6	UTSW	17	74696297	missense	probably damaging	1.00
R0449:Birc6	UTSW	17	74692295	missense	probably damaging	1.00
R0453:Birc6	UTSW	17	74649754	missense	probably damaging	1.00
R0457:Birc6	UTSW	17	74652028	missense	probably benign
R0457:Birc6	UTSW	17	74662625	missense	probably damaging	1.00
R0564:Birc6	UTSW	17	74625243	splice site	probably benign
R0575:Birc6	UTSW	17	74689237	missense	probably damaging	1.00
R0582:Birc6	UTSW	17	74643337	missense	probably damaging	1.00
R0624:Birc6	UTSW	17	74580349	missense	probably benign	0.20
R1061:Birc6	UTSW	17	74689312	missense	probably damaging	1.00
R1378:Birc6	UTSW	17	74660455	missense	probably damaging	1.00
R1402:Birc6	UTSW	17	74697533	splice site	probably benign
R1436:Birc6	UTSW	17	74652705	missense	probably damaging	1.00
R1456:Birc6	UTSW	17	74609290	missense	probably benign	0.35
R1465:Birc6	UTSW	17	74623858	missense	probably benign	0.03
R1465:Birc6	UTSW	17	74623858	missense	probably benign	0.03
R1474:Birc6	UTSW	17	74579678	missense	probably damaging	0.98
R1479:Birc6	UTSW	17	74634853	missense	probably damaging	1.00
R1486:Birc6	UTSW	17	74639820	missense	probably damaging	1.00
R1499:Birc6	UTSW	17	74612319	missense	probably damaging	1.00
R1515:Birc6	UTSW	17	74528636	nonsense	probably null
R1549:Birc6	UTSW	17	74662742	missense	probably damaging	1.00
R1559:Birc6	UTSW	17	74692237	missense	probably damaging	1.00
R1573:Birc6	UTSW	17	74660690	splice site	probably benign
R1615:Birc6	UTSW	17	74609409	splice site	probably null
R1621:Birc6	UTSW	17	74670250	missense	probably benign
R1680:Birc6	UTSW	17	74548746	missense	probably benign	0.01
R1743:Birc6	UTSW	17	74579756	missense	possibly damaging	0.95
R1774:Birc6	UTSW	17	74640013	missense	probably damaging	1.00
R1775:Birc6	UTSW	17	74612286	missense	probably damaging	1.00
R1818:Birc6	UTSW	17	74649849	missense	probably damaging	1.00
R1836:Birc6	UTSW	17	74614390	missense	probably benign	0.41
R1931:Birc6	UTSW	17	74565982	missense	probably damaging	0.99
R1939:Birc6	UTSW	17	74670337	missense	probably damaging	1.00
R1964:Birc6	UTSW	17	74634885	missense	possibly damaging	0.94
R1994:Birc6	UTSW	17	74598062	missense	probably benign	0.01
R2000:Birc6	UTSW	17	74604619	missense	possibly damaging	0.46
R2042:Birc6	UTSW	17	74609659	missense	probably damaging	1.00
R2090:Birc6	UTSW	17	74662796	missense	probably benign
R2130:Birc6	UTSW	17	74659154	splice site	probably benign
R2144:Birc6	UTSW	17	74660413	missense	possibly damaging	0.71
R2145:Birc6	UTSW	17	74660413	missense	possibly damaging	0.71
R2166:Birc6	UTSW	17	74635795	missense	probably benign	0.02
R2180:Birc6	UTSW	17	74612151	missense	probably benign	0.03
R2271:Birc6	UTSW	17	74602971	missense	probably benign	0.06
R2272:Birc6	UTSW	17	74602971	missense	probably benign	0.06
R2416:Birc6	UTSW	17	74608219	missense	possibly damaging	0.83
R2420:Birc6	UTSW	17	74660614	missense	probably damaging	1.00
R2421:Birc6	UTSW	17	74660614	missense	probably damaging	1.00
R2422:Birc6	UTSW	17	74660614	missense	probably damaging	1.00
R2513:Birc6	UTSW	17	74647729	missense	probably damaging	0.97
R2912:Birc6	UTSW	17	74692206	missense	probably damaging	1.00
R3024:Birc6	UTSW	17	74608219	missense	possibly damaging	0.83
R3771:Birc6	UTSW	17	74618429	splice site	probably benign
R3772:Birc6	UTSW	17	74618429	splice site	probably benign
R3829:Birc6	UTSW	17	74655178	missense	probably damaging	1.00
R3913:Birc6	UTSW	17	74573613	nonsense	probably null
R3915:Birc6	UTSW	17	74579608	missense	probably benign	0.12
R3921:Birc6	UTSW	17	74627019	missense	probably damaging	0.98
R3928:Birc6	UTSW	17	74611175	missense	possibly damaging	0.91
R3928:Birc6	UTSW	17	74638409	missense	probably damaging	1.00
R4111:Birc6	UTSW	17	74566015	missense	probably damaging	1.00
R4155:Birc6	UTSW	17	74596939	missense	probably benign	0.00
R4163:Birc6	UTSW	17	74626980	missense	probably damaging	1.00
R4226:Birc6	UTSW	17	74619840	critical splice donor site	probably null
R4227:Birc6	UTSW	17	74619840	critical splice donor site	probably null
R4358:Birc6	UTSW	17	74619668	splice site	probably null
R4524:Birc6	UTSW	17	74641777	missense	probably damaging	1.00
R4605:Birc6	UTSW	17	74639934	missense	probably damaging	1.00
R4619:Birc6	UTSW	17	74640150	missense	probably benign	0.18
R4620:Birc6	UTSW	17	74640150	missense	probably benign	0.18
R4762:Birc6	UTSW	17	74629489	missense	probably damaging	1.00
R4814:Birc6	UTSW	17	74649672	missense	probably damaging	1.00
R4849:Birc6	UTSW	17	74647388	missense	probably damaging	0.99
R4869:Birc6	UTSW	17	74586012	missense	probably benign	0.05
R4912:Birc6	UTSW	17	74565905	missense	probably damaging	1.00
R4921:Birc6	UTSW	17	74650099	missense	probably damaging	1.00
R4942:Birc6	UTSW	17	74623050	missense	probably damaging	1.00
R4954:Birc6	UTSW	17	74612031	missense	probably damaging	1.00
R4992:Birc6	UTSW	17	74689256	missense	probably benign	0.44
R4994:Birc6	UTSW	17	74594324	intron	probably benign
R5018:Birc6	UTSW	17	74640059	missense	probably damaging	1.00
R5022:Birc6	UTSW	17	74692332	missense	probably damaging	1.00
R5054:Birc6	UTSW	17	74655325	missense	probably damaging	1.00
R5068:Birc6	UTSW	17	74565972	missense	probably damaging	1.00
R5069:Birc6	UTSW	17	74565972	missense	probably damaging	1.00
R5070:Birc6	UTSW	17	74565972	missense	probably damaging	1.00
R5196:Birc6	UTSW	17	74606141	splice site	probably benign
R5209:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5212:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5216:Birc6	UTSW	17	74613470	missense	probably damaging	1.00
R5279:Birc6	UTSW	17	74650047	missense	probably damaging	0.98
R5286:Birc6	UTSW	17	74670247	missense	probably damaging	1.00
R5399:Birc6	UTSW	17	74604578	missense	possibly damaging	0.75
R5482:Birc6	UTSW	17	74641782	missense	possibly damaging	0.86
R5482:Birc6	UTSW	17	74662690	missense	probably damaging	1.00
R5492:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5504:Birc6	UTSW	17	74655213	missense	probably damaging	1.00
R5519:Birc6	UTSW	17	74580178	missense	probably benign
R5544:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5608:Birc6	UTSW	17	74613544	missense	probably damaging	0.99
R5623:Birc6	UTSW	17	74528656	missense	probably damaging	0.99
R5701:Birc6	UTSW	17	74697425	missense	possibly damaging	0.59
R5707:Birc6	UTSW	17	74696404	missense	probably damaging	1.00
R5715:Birc6	UTSW	17	74631620	missense	probably damaging	1.00
R5734:Birc6	UTSW	17	74618424	splice site	probably benign
R5792:Birc6	UTSW	17	74631053	missense	probably benign	0.05
R5809:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5810:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5813:Birc6	UTSW	17	74646502	missense	probably damaging	1.00
R5933:Birc6	UTSW	17	74599237	missense	probably damaging	1.00
R5933:Birc6	UTSW	17	74599238	missense	probably damaging	0.98
R5960:Birc6	UTSW	17	74528765	missense	probably damaging	0.97
R5961:Birc6	UTSW	17	74646601	missense	probably damaging	1.00
R5967:Birc6	UTSW	17	74660439	missense	probably damaging	0.99
R5970:Birc6	UTSW	17	74618502	missense	possibly damaging	0.95
R5977:Birc6	UTSW	17	74603036	missense	probably damaging	1.00
R5982:Birc6	UTSW	17	74648158	missense	probably benign
R6023:Birc6	UTSW	17	74654377	missense	probably benign	0.24
R6034:Birc6	UTSW	17	74615283	missense	probably damaging	1.00
R6034:Birc6	UTSW	17	74615283	missense	probably damaging	1.00
R6243:Birc6	UTSW	17	74609387	missense	probably damaging	0.96
R6294:Birc6	UTSW	17	74689257	missense	probably benign	0.00
R6327:Birc6	UTSW	17	74662779	missense	probably damaging	1.00
R6501:Birc6	UTSW	17	74579281	missense	probably damaging	1.00
R6810:Birc6	UTSW	17	74612220	missense	possibly damaging	0.63
R6822:Birc6	UTSW	17	74580382	missense	possibly damaging	0.82
R6822:Birc6	UTSW	17	74598044	missense	probably damaging	1.00
R6835:Birc6	UTSW	17	74642504	missense	probably damaging	1.00
R6945:Birc6	UTSW	17	74579531	missense	probably benign	0.04
R6957:Birc6	UTSW	17	74579491	missense	probably benign
R6989:Birc6	UTSW	17	74630989	missense	probably benign	0.18
R6991:Birc6	UTSW	17	74562095	missense	probably damaging	1.00
R7019:Birc6	UTSW	17	74609345	missense	probably benign	0.01
R7092:Birc6	UTSW	17	74646745	missense	probably damaging	1.00
R7158:Birc6	UTSW	17	74594376	missense	probably benign	0.25
R7204:Birc6	UTSW	17	74640108	missense	probably damaging	1.00
R7267:Birc6	UTSW	17	74585985	missense	probably benign	0.00
R7316:Birc6	UTSW	17	74604494	missense	probably damaging	0.99
R7341:Birc6	UTSW	17	74612074	missense	probably damaging	1.00
R7404:Birc6	UTSW	17	74639794	missense	possibly damaging	0.73
R7449:Birc6	UTSW	17	74702341	missense	probably benign
R7498:Birc6	UTSW	17	74660470	missense	probably damaging	1.00
R7539:Birc6	UTSW	17	74649696	missense	probably damaging	1.00
R7569:Birc6	UTSW	17	74598082	missense	possibly damaging	0.71
R7574:Birc6	UTSW	17	74579884	missense	probably benign
R7611:Birc6	UTSW	17	74662718	missense	probably damaging	0.98
R7653:Birc6	UTSW	17	74647734	missense	possibly damaging	0.91
R7716:Birc6	UTSW	17	74562061	missense	probably damaging	0.99
R7728:Birc6	UTSW	17	74622105	missense	probably benign	0.01
R7810:Birc6	UTSW	17	74548820	missense	probably damaging	0.98
R7828:Birc6	UTSW	17	74579506	missense	probably damaging	0.97
R7881:Birc6	UTSW	17	74641671	missense	probably damaging	0.99
R7896:Birc6	UTSW	17	74622082	missense	probably damaging	0.99
R7950:Birc6	UTSW	17	74593100	missense	probably damaging	1.00
R7988:Birc6	UTSW	17	74599373	splice site	probably null
R8073:Birc6	UTSW	17	74603085	missense	probably damaging	1.00
R8128:Birc6	UTSW	17	74609258	missense	probably damaging	1.00
R8167:Birc6	UTSW	17	74643394	missense	probably damaging	1.00
R8236:Birc6	UTSW	17	74611131	missense	probably damaging	1.00
R8237:Birc6	UTSW	17	74611131	missense	probably damaging	1.00
R8255:Birc6	UTSW	17	74662780	missense	probably damaging	0.99
R8259:Birc6	UTSW	17	74598078	missense	probably benign	0.01
R8297:Birc6	UTSW	17	74625104	critical splice acceptor site	probably null
R8376:Birc6	UTSW	17	74589640	missense	probably benign	0.18
R8413:Birc6	UTSW	17	74546393	missense	possibly damaging	0.54
R8503:Birc6	UTSW	17	74692244	missense	probably damaging	1.00
R8504:Birc6	UTSW	17	74652005	missense	probably damaging	0.98
R8543:Birc6	UTSW	17	74565865	missense	probably damaging	1.00
R8550:Birc6	UTSW	17	74557954	missense	probably benign	0.37
R8551:Birc6	UTSW	17	74557954	missense	probably benign	0.37
R8556:Birc6	UTSW	17	74557954	missense	probably benign	0.37
R8683:Birc6	UTSW	17	74609119	missense	possibly damaging	0.74
R8751:Birc6	UTSW	17	74648140	missense	probably damaging	0.98
R8803:Birc6	UTSW	17	74652038	missense	probably damaging	0.99
R8806:Birc6	UTSW	17	74642316	missense	probably damaging	1.00
R8825:Birc6	UTSW	17	74613505	missense	probably damaging	0.99
R8888:Birc6	UTSW	17	74528538	missense	probably null	0.33
R8972:Birc6	UTSW	17	74702318	missense	probably benign	0.05
R9069:Birc6	UTSW	17	74561265	splice site	probably benign
R9111:Birc6	UTSW	17	74659345	missense	probably damaging	0.99
R9130:Birc6	UTSW	17	74612151	missense
R9352:Birc6	UTSW	17	74658352	critical splice donor site	probably null
R9354:Birc6	UTSW	17	74614406	missense	probably benign
R9432:Birc6	UTSW	17	74659221	missense	probably benign
R9446:Birc6	UTSW	17	74618496	missense	probably damaging	1.00
R9485:Birc6	UTSW	17	74638403	missense	probably damaging	1.00
R9499:Birc6	UTSW	17	74609069	missense	probably benign	0.05
R9551:Birc6	UTSW	17	74609069	missense	probably benign	0.05
R9552:Birc6	UTSW	17	74609069	missense	probably benign	0.05
R9585:Birc6	UTSW	17	74609270	missense	probably damaging	1.00
R9647:Birc6	UTSW	17	74692310	missense	probably damaging	1.00
R9648:Birc6	UTSW	17	74631701	missense	probably damaging	1.00
R9667:Birc6	UTSW	17	74697425	missense	possibly damaging	0.59
R9696:Birc6	UTSW	17	74640297	missense	probably damaging	0.99
RF016:Birc6	UTSW	17	74689324	missense	probably damaging	1.00
Z1088:Birc6	UTSW	17	74611542	missense	probably damaging	0.99
Z1177:Birc6	UTSW	17	74647280	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GGATTCTAGTACTTGCCTGCC -3'
(R):5'- GCACGATTGCTGGGTCATAG -3'

Sequencing Primer
(F):5'- TCCACAGCCCACTATATAAAAATGG -3'
(R):5'- GCTGGGTCATAGGCATTAATTTC -3'

Posted On

2014-10-02