Mutagenetix > Incidental Mutation

Incidental Mutation 'R0201:Dip2b'

23676

Institutional Source

Beutler Lab

Gene Symbol

Dip2b

Ensembl Gene

ENSMUSG00000023026

Gene Name

disco interacting protein 2 homolog B

Synonyms

MMRRC Submission

038458-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.709) question?

Stock #

R0201 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100038664-100219473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100186147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 884 (D884N)

Ref Sequence

ENSEMBL: ENSMUSP00000097777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]

AlphaFold

Q3UH60

Predicted Effect

probably benign
Transcript: ENSMUST00000023768
AA Change: D650N

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: D650N

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	109	584	9.5e-26	PFAM
Pfam:AMP-binding	760	1235	1.2e-52	PFAM
low complexity region	1299	1311	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100203
AA Change: D884N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: D884N

Domain	Start	End	E-Value	Type
DMAP_binding	12	130	1e-42	SMART
low complexity region	152	168	N/A	INTRINSIC
low complexity region	181	192	N/A	INTRINSIC
Pfam:AMP-binding	341	817	2e-26	PFAM
Pfam:AMP-binding	993	1468	1.8e-64	PFAM
low complexity region	1532	1544	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108971
AA Change: D650N

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: D650N

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	583	9.5e-26	PFAM
Pfam:AMP-binding	759	1234	1.2e-52	PFAM
low complexity region	1298	1310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229080

Meta Mutation Damage Score

0.3342

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.2%

Validation Efficiency

97% (91/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	G	14: 68,581,957		probably null	Het
Adamts16	T	A	13: 70,779,644	Q492L	possibly damaging	Het
Aplnr	A	G	2: 85,137,177	D182G	probably damaging	Het
Arnt2	G	T	7: 84,361,659	S3*	probably null	Het
Asxl3	T	C	18: 22,523,154	V1407A	probably benign	Het
Atg13	A	T	2: 91,684,762		probably null	Het
Atm	A	T	9: 53,454,279		probably benign	Het
Birc6	T	G	17: 74,609,327	V1746G	possibly damaging	Het
Cbln1	G	T	8: 87,472,113	T43K	probably benign	Het
Cbx5	T	C	15: 103,199,700	T173A	probably damaging	Het
Cc2d2a	A	G	5: 43,737,512	Y1437C	probably damaging	Het
Ccdc78	C	A	17: 25,789,236		probably benign	Het
Cd2bp2	A	G	7: 127,193,828	Y341H	probably damaging	Het
Cdhr5	T	A	7: 141,276,378	D88V	probably damaging	Het
Ces1f	T	A	8: 93,267,329	T275S	probably null	Het
Clca4a	T	C	3: 144,960,717	N458S	probably benign	Het
Cog5	A	G	12: 31,839,841	K521R	probably damaging	Het
Csf2ra	T	A	19: 61,225,568	T305S	probably benign	Het
Csmd3	T	A	15: 47,619,729		probably benign	Het
Cts6	T	A	13: 61,201,499	R132*	probably null	Het
D5Ertd579e	G	T	5: 36,616,465	N195K	probably damaging	Het
Ddx1	A	G	12: 13,223,808	V606A	probably damaging	Het
Ehhadh	A	G	16: 21,773,493		probably null	Het
Enpp1	T	A	10: 24,653,917	T608S	probably benign	Het
Fancm	T	C	12: 65,101,632	Y674H	probably damaging	Het
Fat4	T	A	3: 38,891,596	V1546D	probably damaging	Het
Fsd1	G	A	17: 55,990,522	A158T	probably benign	Het
Fzd2	T	A	11: 102,606,122	M464K	probably damaging	Het
Gjc2	A	G	11: 59,177,590	F22S	possibly damaging	Het
Gm13101	T	C	4: 143,964,890	E421G	probably damaging	Het
Gria2	T	C	3: 80,707,838	Y445C	probably damaging	Het
Hsdl1	T	A	8: 119,566,256	I147F	possibly damaging	Het
Ifi44	T	C	3: 151,745,636	Y226C	probably damaging	Het
Il16	A	G	7: 83,722,308	C97R	probably damaging	Het
Impg1	A	T	9: 80,345,561	S369T	probably damaging	Het
Jmjd1c	A	G	10: 67,219,109	T390A	unknown	Het
Lgi1	A	G	19: 38,301,293	E269G	possibly damaging	Het
Lrp6	G	T	6: 134,450,897	Y1577*	probably null	Het
Lrrc74a	G	T	12: 86,761,773		probably benign	Het
Man1c1	A	T	4: 134,640,398		probably null	Het
Map1lc3b	A	C	8: 121,590,550	Q9P	possibly damaging	Het
Mboat1	G	A	13: 30,202,375	R124H	probably benign	Het
Mcu	A	G	10: 59,456,677	L60P	probably damaging	Het
Mrs2	G	T	13: 25,018,534	Q75K	probably benign	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Neb	G	A	2: 52,206,878		probably benign	Het
Nlrp2	C	T	7: 5,328,329	G356D	probably benign	Het
Notch3	A	G	17: 32,156,148		probably benign	Het
Npr2	A	C	4: 43,641,617	S474R	probably damaging	Het
Nupl1	A	G	14: 60,244,616	F100L	probably benign	Het
Osbpl6	A	C	2: 76,546,042	D87A	possibly damaging	Het
Pabpc2	A	T	18: 39,775,307	M542L	probably benign	Het
Papln	A	G	12: 83,783,027		probably benign	Het
Parpbp	T	C	10: 88,092,896	I561V	possibly damaging	Het
Pcdhb13	C	T	18: 37,442,581	A4V	probably benign	Het
Pelp1	T	C	11: 70,395,704	T533A	possibly damaging	Het
Poldip3	T	A	15: 83,135,296	M182L	probably benign	Het
Por	T	C	5: 135,731,178	S240P	possibly damaging	Het
Pramef20	A	T	4: 144,377,273		probably benign	Het
Prss22	A	T	17: 23,996,301	V167D	probably damaging	Het
Prss37	A	C	6: 40,516,349	L61R	probably damaging	Het
Psmd1	C	T	1: 86,118,616	T702M	probably benign	Het
Pxdn	G	T	12: 30,002,431	G869V	possibly damaging	Het
Rabgap1l	A	G	1: 160,453,745		probably benign	Het
Rapgef6	T	C	11: 54,619,941	V228A	probably damaging	Het
Rnf169	T	C	7: 99,926,003	R462G	possibly damaging	Het
Rnft2	A	G	5: 118,194,680		probably benign	Het
Sgo2b	T	C	8: 63,926,636	D1054G	probably benign	Het
Sh3bgr	T	C	16: 96,228,517		probably benign	Het
Slc12a4	A	G	8: 105,945,350	V910A	possibly damaging	Het
Slc6a12	A	T	6: 121,355,372	I222F	probably benign	Het
Spty2d1	G	A	7: 46,997,901	R427*	probably null	Het
Ssc5d	A	G	7: 4,944,663	T1339A	probably benign	Het
Sspo	A	C	6: 48,455,752	E854A	possibly damaging	Het
Stx7	A	G	10: 24,185,079		probably benign	Het
Styk1	A	T	6: 131,301,730		probably benign	Het
Tex33	T	A	15: 78,378,828	M209L	probably damaging	Het
Tmem163	T	G	1: 127,668,637		probably benign	Het
Tmppe	C	CT	9: 114,404,639		probably null	Het
Tmx2	A	G	2: 84,673,082	V229A	probably benign	Het
Top2b	T	C	14: 16,383,174	L54P	probably damaging	Het
Trim62	A	T	4: 128,902,550	Y280F	probably benign	Het
Tssk4	A	T	14: 55,651,559	K181*	probably null	Het
Tssk4	A	T	14: 55,651,560	K181M	probably damaging	Het
Ubn1	A	G	16: 5,064,614	D313G	probably damaging	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Ugt1a10	C	T	1: 88,218,249	P473L	probably damaging	Het

Other mutations in Dip2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Dip2b	APN	15	100174501	missense	probably damaging	1.00
IGL01716:Dip2b	APN	15	100209636	missense	probably benign	0.00
IGL01893:Dip2b	APN	15	100171220	splice site	probably benign
IGL01915:Dip2b	APN	15	100178511	missense	probably damaging	1.00
IGL02125:Dip2b	APN	15	100186250	missense	possibly damaging	0.60
IGL02200:Dip2b	APN	15	100151202	missense	possibly damaging	0.93
IGL02506:Dip2b	APN	15	100157281	missense	probably damaging	1.00
IGL02571:Dip2b	APN	15	100157885	missense	possibly damaging	0.93
IGL02706:Dip2b	APN	15	100215311	missense	probably damaging	0.98
IGL02983:Dip2b	APN	15	100132022	missense	possibly damaging	0.81
IGL03120:Dip2b	APN	15	100203127	splice site	probably benign
IGL03181:Dip2b	APN	15	100215207	missense	probably damaging	0.98
IGL03229:Dip2b	APN	15	100207838	splice site	probably benign
IGL03399:Dip2b	APN	15	100175327	missense	possibly damaging	0.63
PIT4131001:Dip2b	UTSW	15	100202352	missense	probably damaging	1.00
R0009:Dip2b	UTSW	15	100169312	missense	probably damaging	1.00
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0092:Dip2b	UTSW	15	100202265	missense	probably damaging	1.00
R0359:Dip2b	UTSW	15	100211993	missense	probably damaging	0.98
R0390:Dip2b	UTSW	15	100193913	missense	probably damaging	0.99
R0564:Dip2b	UTSW	15	100162719	nonsense	probably null
R0730:Dip2b	UTSW	15	100171651	missense	probably damaging	1.00
R1144:Dip2b	UTSW	15	100154250	missense	probably benign	0.11
R1200:Dip2b	UTSW	15	100209745	missense	probably benign	0.00
R1506:Dip2b	UTSW	15	100183113	missense	probably damaging	1.00
R1750:Dip2b	UTSW	15	100178466	missense	probably benign
R1760:Dip2b	UTSW	15	100212029	missense	probably damaging	1.00
R1773:Dip2b	UTSW	15	100193961	missense	probably benign	0.00
R1812:Dip2b	UTSW	15	100198938	splice site	probably null
R2264:Dip2b	UTSW	15	100203216	missense	probably benign	0.05
R3105:Dip2b	UTSW	15	100142137	nonsense	probably null
R4029:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4030:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4296:Dip2b	UTSW	15	100181336	missense	probably benign
R4392:Dip2b	UTSW	15	100162036	missense	probably damaging	1.00
R4480:Dip2b	UTSW	15	100186301	missense	probably damaging	0.99
R4564:Dip2b	UTSW	15	100157258	nonsense	probably null
R4605:Dip2b	UTSW	15	100209636	missense	probably benign	0.00
R4606:Dip2b	UTSW	15	100215329	missense	possibly damaging	0.91
R4634:Dip2b	UTSW	15	100160491	missense	probably damaging	1.00
R4667:Dip2b	UTSW	15	100151360	missense	probably benign	0.01
R4739:Dip2b	UTSW	15	100207777	missense	probably damaging	0.98
R4826:Dip2b	UTSW	15	100169281	missense	probably damaging	0.99
R4870:Dip2b	UTSW	15	100195784	splice site	probably null
R4877:Dip2b	UTSW	15	100160529	missense	possibly damaging	0.49
R4932:Dip2b	UTSW	15	100171722	missense	probably damaging	1.00
R5009:Dip2b	UTSW	15	100195784	splice site	probably null
R5169:Dip2b	UTSW	15	100205113	missense	probably damaging	1.00
R5216:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5218:Dip2b	UTSW	15	100154296	missense	probably benign	0.00
R5274:Dip2b	UTSW	15	100212104	missense	possibly damaging	0.54
R5370:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5420:Dip2b	UTSW	15	100205173	intron	probably benign
R5447:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5670:Dip2b	UTSW	15	100190104	missense	possibly damaging	0.80
R5768:Dip2b	UTSW	15	100157945	missense	probably benign	0.32
R5908:Dip2b	UTSW	15	100151184	missense	possibly damaging	0.93
R5957:Dip2b	UTSW	15	100209694	missense	probably benign	0.03
R5987:Dip2b	UTSW	15	100190079	missense	probably damaging	1.00
R6260:Dip2b	UTSW	15	100162702	missense	probably benign	0.05
R6325:Dip2b	UTSW	15	100154282	missense	probably benign	0.00
R6367:Dip2b	UTSW	15	100115914	missense	possibly damaging	0.50
R6391:Dip2b	UTSW	15	100151276	missense	probably damaging	1.00
R6422:Dip2b	UTSW	15	100199011	missense	probably damaging	0.98
R6818:Dip2b	UTSW	15	100193954	missense	probably benign	0.09
R6922:Dip2b	UTSW	15	100193843	missense	probably benign	0.25
R7002:Dip2b	UTSW	15	100160465	missense	probably benign	0.43
R7076:Dip2b	UTSW	15	100157972	splice site	probably null
R7176:Dip2b	UTSW	15	100169318	missense	probably damaging	1.00
R7255:Dip2b	UTSW	15	100209627	missense	probably benign	0.00
R7463:Dip2b	UTSW	15	100154157	missense	probably benign
R7513:Dip2b	UTSW	15	100207748	splice site	probably null
R7876:Dip2b	UTSW	15	100191041	missense	probably benign	0.02
R8368:Dip2b	UTSW	15	100154243	missense	probably benign	0.00
R9289:Dip2b	UTSW	15	100173271	missense	probably damaging	0.97
R9405:Dip2b	UTSW	15	100195876	missense	probably benign	0.05
R9477:Dip2b	UTSW	15	100038903	missense	probably damaging	1.00
R9485:Dip2b	UTSW	15	100155043	missense	probably benign	0.05
R9533:Dip2b	UTSW	15	100175297	missense	probably benign	0.06
R9581:Dip2b	UTSW	15	100181374	missense	probably damaging	0.99
R9666:Dip2b	UTSW	15	100209580	missense	probably damaging	1.00
X0064:Dip2b	UTSW	15	100115850	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTGCTTCACTGCACATTTACACG -3'
(R):5'- GTGGGCACATGAGGATATTACACGG -3'

Sequencing Primer
(F):5'- ACACGTCAGACAGTTCCTTGG -3'
(R):5'- TACACGGGTGTAGAGAACCCTC -3'

Posted On

2013-04-16