Incidental Mutation 'R2208:Pax1'
ID 236761
Institutional Source Beutler Lab
Gene Symbol Pax1
Ensembl Gene ENSMUSG00000037034
Gene Name paired box 1
Synonyms Pax-1, hunchback, wavy tail, hbs, wt
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 147361925-147393295 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 147365802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 198 (I198N)
Ref Sequence ENSEMBL: ENSMUSP00000119667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109968] [ENSMUST00000126068]
AlphaFold P09084
Predicted Effect probably damaging
Transcript: ENSMUST00000109968
AA Change: I110N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105594
Gene: ENSMUSG00000037034
AA Change: I110N

low complexity region 9 55 N/A INTRINSIC
PAX 89 213 9.13e-91 SMART
low complexity region 380 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126068
AA Change: I198N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119667
Gene: ENSMUSG00000037034
AA Change: I198N

low complexity region 97 143 N/A INTRINSIC
PAX 177 301 9.13e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156584
Meta Mutation Damage Score 0.9352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. This gene plays a role in pattern formation during embryogenesis and may be essential for development of the vertebral column. This gene is silenced by methylation in ovarian and cervical cancers and may be a tumor suppressor gene. Mutations in this gene are also associated with vertebral malformations. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for several mutations exhibit variably severe morphological alterations of vertebral column, sternum, scapula, skull, and thymus, with reduced adult survival and fertility. Some heterozygotes show milder skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Pax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
wavy UTSW 2 147365802 missense probably damaging 1.00
R0030:Pax1 UTSW 2 147368582 missense probably damaging 0.99
R0147:Pax1 UTSW 2 147373734 missense probably benign 0.17
R0304:Pax1 UTSW 2 147366147 missense probably benign 0.20
R1544:Pax1 UTSW 2 147368401 missense probably damaging 0.99
R1583:Pax1 UTSW 2 147366255 missense possibly damaging 0.94
R1937:Pax1 UTSW 2 147367889 missense possibly damaging 0.78
R2143:Pax1 UTSW 2 147365882 missense probably damaging 1.00
R2915:Pax1 UTSW 2 147368428 missense probably damaging 1.00
R3878:Pax1 UTSW 2 147362308 unclassified probably benign
R4788:Pax1 UTSW 2 147366204 missense possibly damaging 0.94
R6323:Pax1 UTSW 2 147368401 missense probably damaging 1.00
R6842:Pax1 UTSW 2 147373720 missense probably benign 0.00
R7052:Pax1 UTSW 2 147365904 missense probably damaging 1.00
R7117:Pax1 UTSW 2 147366270 missense probably damaging 0.98
R7703:Pax1 UTSW 2 147366114 missense probably damaging 1.00
R8487:Pax1 UTSW 2 147365048 start codon destroyed probably null
R8958:Pax1 UTSW 2 147368597 critical splice donor site probably null
R9092:Pax1 UTSW 2 147362367 missense unknown
Z1177:Pax1 UTSW 2 147368511 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-02