Incidental Mutation 'R2208:Zfp1004'
ID 236762
Institutional Source Beutler Lab
Gene Symbol Zfp1004
Ensembl Gene ENSMUSG00000079009
Gene Name zinc finger protein 1004
Synonyms Gm14139
MMRRC Submission 040210-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 150023675-150035199 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150035065 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 462 (V462E)
Ref Sequence ENSEMBL: ENSMUSP00000105552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109926] [ENSMUST00000109929]
AlphaFold F6ZS36
Predicted Effect probably benign
Transcript: ENSMUST00000109926
AA Change: V462E

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105552
Gene: ENSMUSG00000079009
AA Change: V462E

DomainStartEndE-ValueType
Blast:KRAB 1 34 7e-15 BLAST
ZnF_C2H2 71 93 8.6e-5 SMART
ZnF_C2H2 99 121 1.76e-1 SMART
ZnF_C2H2 127 149 3.02e0 SMART
ZnF_C2H2 183 205 6.08e-5 SMART
ZnF_C2H2 211 233 1.04e-3 SMART
ZnF_C2H2 239 261 2.57e-3 SMART
ZnF_C2H2 267 289 1.06e-4 SMART
ZnF_C2H2 295 317 2.2e-2 SMART
ZnF_C2H2 323 345 4.47e-3 SMART
ZnF_C2H2 351 373 7.37e-4 SMART
ZnF_C2H2 379 401 4.24e-4 SMART
ZnF_C2H2 407 429 1.2e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109929
AA Change: V493E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105555
Gene: ENSMUSG00000079009
AA Change: V493E

DomainStartEndE-ValueType
KRAB 3 65 1.65e-15 SMART
ZnF_C2H2 102 124 8.6e-5 SMART
ZnF_C2H2 130 152 1.76e-1 SMART
ZnF_C2H2 158 180 3.02e0 SMART
ZnF_C2H2 214 236 6.08e-5 SMART
ZnF_C2H2 242 264 1.04e-3 SMART
ZnF_C2H2 270 292 2.57e-3 SMART
ZnF_C2H2 298 320 1.06e-4 SMART
ZnF_C2H2 326 348 2.2e-2 SMART
ZnF_C2H2 354 376 4.47e-3 SMART
ZnF_C2H2 382 404 7.37e-4 SMART
ZnF_C2H2 410 432 4.24e-4 SMART
ZnF_C2H2 438 460 1.2e-3 SMART
ZnF_C2H2 466 488 2.61e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,995,096 (GRCm39) V5460A probably benign Het
Bco2 A G 9: 50,444,755 (GRCm39) V517A probably damaging Het
Brca2 T A 5: 150,455,809 (GRCm39) D183E probably damaging Het
Ccdc142 T C 6: 83,084,941 (GRCm39) probably null Het
Ccdc39 A G 3: 33,895,327 (GRCm39) L34P probably damaging Het
Cdc42bpb T A 12: 111,302,463 (GRCm39) H198L probably damaging Het
Cdc73 T A 1: 143,485,120 (GRCm39) E516V probably damaging Het
Cep170b T A 12: 112,705,419 (GRCm39) L1059Q probably benign Het
Chrm1 T C 19: 8,655,463 (GRCm39) L56P probably damaging Het
Clec4d T A 6: 123,242,314 (GRCm39) V22D probably damaging Het
Cplane1 T A 15: 8,223,887 (GRCm39) N883K probably benign Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp2d12 T C 15: 82,441,137 (GRCm39) L141P probably damaging Het
Cyp4x1 G T 4: 114,983,791 (GRCm39) Q85K probably benign Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Enpp7 T C 11: 118,879,588 (GRCm39) probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fitm2 T A 2: 163,314,604 (GRCm39) probably benign Het
Gng10 T A 4: 59,035,314 (GRCm39) I26N possibly damaging Het
Gpr33 C T 12: 52,070,236 (GRCm39) V268I probably benign Het
Hmcn2 G A 2: 31,270,309 (GRCm39) C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Krt36 C T 11: 99,993,765 (GRCm39) V358M probably damaging Het
Lmod3 T C 6: 97,224,838 (GRCm39) I328V probably benign Het
Lrp8 T C 4: 107,712,987 (GRCm39) V580A probably damaging Het
Masp2 T C 4: 148,698,872 (GRCm39) I651T probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Msi2 A T 11: 88,480,934 (GRCm39) S118T probably damaging Het
Muc19 T C 15: 91,755,747 (GRCm39) noncoding transcript Het
Nabp1 G A 1: 51,516,773 (GRCm39) R32* probably null Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nup88 T C 11: 70,856,545 (GRCm39) D196G probably damaging Het
Or11h4b T C 14: 50,919,020 (GRCm39) I24V probably benign Het
Pax1 T A 2: 147,207,722 (GRCm39) I198N probably damaging Het
Pde3a A G 6: 141,196,073 (GRCm39) E253G probably damaging Het
Phldb1 C T 9: 44,607,428 (GRCm39) R1192Q probably damaging Het
Pianp C A 6: 124,976,602 (GRCm39) P137Q probably damaging Het
Prdm15 A C 16: 97,600,464 (GRCm39) probably null Het
Ptprf A T 4: 118,126,369 (GRCm39) probably benign Het
Rfx7 A G 9: 72,525,246 (GRCm39) D812G probably benign Het
Rgs22 T C 15: 36,050,378 (GRCm39) T691A probably benign Het
Rundc3a A T 11: 102,292,914 (GRCm39) S436C probably damaging Het
Sntb1 T C 15: 55,769,714 (GRCm39) T92A possibly damaging Het
Tars3 T C 7: 65,332,596 (GRCm39) S566P probably damaging Het
Tbc1d32 A T 10: 56,026,888 (GRCm39) probably null Het
Tep1 T C 14: 51,104,321 (GRCm39) Q191R probably benign Het
Tmc2 C A 2: 130,056,483 (GRCm39) probably null Het
Tns1 A C 1: 74,118,399 (GRCm39) I77S probably damaging Het
Trpd52l3 T C 19: 29,981,646 (GRCm39) W134R probably damaging Het
Vmn2r15 A C 5: 109,445,309 (GRCm39) N38K possibly damaging Het
Wdr90 A T 17: 26,079,362 (GRCm39) D257E probably damaging Het
Zbtb9 T C 17: 27,193,098 (GRCm39) C168R possibly damaging Het
Other mutations in Zfp1004
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0254:Zfp1004 UTSW 2 150,033,784 (GRCm39) missense possibly damaging 0.78
R0505:Zfp1004 UTSW 2 150,035,000 (GRCm39) nonsense probably null
R0562:Zfp1004 UTSW 2 150,034,494 (GRCm39) missense probably damaging 1.00
R1239:Zfp1004 UTSW 2 150,033,891 (GRCm39) missense possibly damaging 0.94
R1878:Zfp1004 UTSW 2 150,034,989 (GRCm39) missense probably damaging 1.00
R1966:Zfp1004 UTSW 2 150,033,827 (GRCm39) missense probably benign 0.00
R2001:Zfp1004 UTSW 2 150,034,867 (GRCm39) missense probably benign 0.00
R3110:Zfp1004 UTSW 2 150,034,141 (GRCm39) missense probably damaging 1.00
R3112:Zfp1004 UTSW 2 150,034,141 (GRCm39) missense probably damaging 1.00
R4135:Zfp1004 UTSW 2 150,023,788 (GRCm39) splice site probably benign
R4299:Zfp1004 UTSW 2 150,032,653 (GRCm39) missense probably damaging 1.00
R4579:Zfp1004 UTSW 2 150,034,143 (GRCm39) missense probably damaging 1.00
R4818:Zfp1004 UTSW 2 150,033,981 (GRCm39) missense probably damaging 1.00
R4894:Zfp1004 UTSW 2 150,033,899 (GRCm39) nonsense probably null
R5432:Zfp1004 UTSW 2 150,033,901 (GRCm39) missense possibly damaging 0.68
R5669:Zfp1004 UTSW 2 150,034,098 (GRCm39) missense probably benign 0.09
R6106:Zfp1004 UTSW 2 150,034,725 (GRCm39) missense probably damaging 1.00
R6857:Zfp1004 UTSW 2 150,033,982 (GRCm39) missense probably damaging 1.00
R7450:Zfp1004 UTSW 2 150,035,046 (GRCm39) missense probably benign 0.04
R8011:Zfp1004 UTSW 2 150,034,266 (GRCm39) missense possibly damaging 0.70
R8519:Zfp1004 UTSW 2 150,034,700 (GRCm39) missense probably benign 0.37
R9482:Zfp1004 UTSW 2 150,034,711 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGTCTCCAAGTGGATTCCTGT -3'
(R):5'- CACACGCCTTTAATTCTAGCACTTG -3'

Sequencing Primer
(F):5'- GTGGTAAATCCTTCATACATCGCAG -3'
(R):5'- ACACTCATAGGGTTTCTCTTTC -3'
Posted On 2014-10-02