Incidental Mutation 'R2208:Gm14139'
ID 236762
Institutional Source Beutler Lab
Gene Symbol Gm14139
Ensembl Gene ENSMUSG00000079009
Gene Name predicted gene 14139
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 150181755-150193279 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150193145 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 462 (V462E)
Ref Sequence ENSEMBL: ENSMUSP00000105552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109926] [ENSMUST00000109929]
AlphaFold F6ZS36
Predicted Effect probably benign
Transcript: ENSMUST00000109926
AA Change: V462E

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105552
Gene: ENSMUSG00000079009
AA Change: V462E

Blast:KRAB 1 34 7e-15 BLAST
ZnF_C2H2 71 93 8.6e-5 SMART
ZnF_C2H2 99 121 1.76e-1 SMART
ZnF_C2H2 127 149 3.02e0 SMART
ZnF_C2H2 183 205 6.08e-5 SMART
ZnF_C2H2 211 233 1.04e-3 SMART
ZnF_C2H2 239 261 2.57e-3 SMART
ZnF_C2H2 267 289 1.06e-4 SMART
ZnF_C2H2 295 317 2.2e-2 SMART
ZnF_C2H2 323 345 4.47e-3 SMART
ZnF_C2H2 351 373 7.37e-4 SMART
ZnF_C2H2 379 401 4.24e-4 SMART
ZnF_C2H2 407 429 1.2e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109929
AA Change: V493E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105555
Gene: ENSMUSG00000079009
AA Change: V493E

KRAB 3 65 1.65e-15 SMART
ZnF_C2H2 102 124 8.6e-5 SMART
ZnF_C2H2 130 152 1.76e-1 SMART
ZnF_C2H2 158 180 3.02e0 SMART
ZnF_C2H2 214 236 6.08e-5 SMART
ZnF_C2H2 242 264 1.04e-3 SMART
ZnF_C2H2 270 292 2.57e-3 SMART
ZnF_C2H2 298 320 1.06e-4 SMART
ZnF_C2H2 326 348 2.2e-2 SMART
ZnF_C2H2 354 376 4.47e-3 SMART
ZnF_C2H2 382 404 7.37e-4 SMART
ZnF_C2H2 410 432 4.24e-4 SMART
ZnF_C2H2 438 460 1.2e-3 SMART
ZnF_C2H2 466 488 2.61e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Gm14139
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0254:Gm14139 UTSW 2 150191864 missense possibly damaging 0.78
R0505:Gm14139 UTSW 2 150193080 nonsense probably null
R0562:Gm14139 UTSW 2 150192574 missense probably damaging 1.00
R1239:Gm14139 UTSW 2 150191971 missense possibly damaging 0.94
R1878:Gm14139 UTSW 2 150193069 missense probably damaging 1.00
R1966:Gm14139 UTSW 2 150191907 missense probably benign 0.00
R2001:Gm14139 UTSW 2 150192947 missense probably benign 0.00
R3110:Gm14139 UTSW 2 150192221 missense probably damaging 1.00
R3112:Gm14139 UTSW 2 150192221 missense probably damaging 1.00
R4135:Gm14139 UTSW 2 150181868 splice site probably benign
R4299:Gm14139 UTSW 2 150190733 missense probably damaging 1.00
R4579:Gm14139 UTSW 2 150192223 missense probably damaging 1.00
R4818:Gm14139 UTSW 2 150192061 missense probably damaging 1.00
R4894:Gm14139 UTSW 2 150191979 nonsense probably null
R5432:Gm14139 UTSW 2 150191981 missense possibly damaging 0.68
R5669:Gm14139 UTSW 2 150192178 missense probably benign 0.09
R6106:Gm14139 UTSW 2 150192805 missense probably damaging 1.00
R6857:Gm14139 UTSW 2 150192062 missense probably damaging 1.00
R7450:Gm14139 UTSW 2 150193126 missense probably benign 0.04
R8011:Gm14139 UTSW 2 150192346 missense possibly damaging 0.70
R8519:Gm14139 UTSW 2 150192780 missense probably benign 0.37
R9482:Gm14139 UTSW 2 150192791 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-02