Incidental Mutation 'R2208:Lrp8'
ID236766
Institutional Source Beutler Lab
Gene Symbol Lrp8
Ensembl Gene ENSMUSG00000028613
Gene Namelow density lipoprotein receptor-related protein 8, apolipoprotein e receptor
SynonymsLr8b, 4932703M08Rik, apoER2
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R2208 (G1)
Quality Score146
Status Validated
Chromosome4
Chromosomal Location107802261-107876840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107855790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 580 (V580A)
Ref Sequence ENSEMBL: ENSMUSP00000115854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030356] [ENSMUST00000106732] [ENSMUST00000106733] [ENSMUST00000126573] [ENSMUST00000143601]
Predicted Effect probably damaging
Transcript: ENSMUST00000030356
AA Change: V539A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030356
Gene: ENSMUSG00000028613
AA Change: V539A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106731
AA Change: V341A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102342
Gene: ENSMUSG00000028613
AA Change: V341A

DomainStartEndE-ValueType
EGF_like 9 47 3.29e1 SMART
LDLa 9 48 2.45e-13 SMART
LDLa 50 89 1.19e-11 SMART
LDLa 93 130 4.58e-13 SMART
EGF 134 170 2.83e-5 SMART
EGF_CA 171 210 9.91e-10 SMART
LY 237 279 8.44e-4 SMART
LY 284 326 2.29e-14 SMART
LY 327 370 5.96e-13 SMART
LY 371 413 4.21e-13 SMART
LY 415 457 7.24e-3 SMART
EGF 484 530 1.56e1 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 586 601 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 666 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106732
AA Change: V454A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102343
Gene: ENSMUSG00000028613
AA Change: V454A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 164 201 4.58e-13 SMART
LDLa 204 244 1.4e-8 SMART
EGF 246 282 2.83e-5 SMART
EGF_CA 283 322 9.91e-10 SMART
LY 349 391 8.44e-4 SMART
LY 396 438 2.29e-14 SMART
LY 439 482 5.96e-13 SMART
LY 483 525 4.21e-13 SMART
LY 527 569 7.24e-3 SMART
EGF 596 642 1.56e1 SMART
low complexity region 644 660 N/A INTRINSIC
low complexity region 698 713 N/A INTRINSIC
transmembrane domain 733 755 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106733
AA Change: V539A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102344
Gene: ENSMUSG00000028613
AA Change: V539A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123140
Predicted Effect possibly damaging
Transcript: ENSMUST00000126573
AA Change: V412A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118020
Gene: ENSMUSG00000028613
AA Change: V412A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 163 200 4.58e-13 SMART
EGF 204 240 2.83e-5 SMART
EGF_CA 241 280 9.91e-10 SMART
LY 307 349 8.44e-4 SMART
LY 354 396 2.29e-14 SMART
LY 397 440 5.96e-13 SMART
LY 441 483 4.21e-13 SMART
LY 485 527 7.24e-3 SMART
EGF 554 600 1.56e1 SMART
transmembrane domain 616 638 N/A INTRINSIC
low complexity region 661 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135022
Predicted Effect probably damaging
Transcript: ENSMUST00000143601
AA Change: V580A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115854
Gene: ENSMUSG00000028613
AA Change: V580A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
LDLa 330 370 1.4e-8 SMART
EGF 372 408 2.83e-5 SMART
EGF_CA 409 448 9.91e-10 SMART
LY 475 517 8.44e-4 SMART
LY 522 564 2.29e-14 SMART
LY 565 608 5.96e-13 SMART
LY 609 651 4.21e-13 SMART
LY 653 695 7.24e-3 SMART
EGF 722 768 1.56e1 SMART
low complexity region 770 786 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
transmembrane domain 859 881 N/A INTRINSIC
low complexity region 904 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147319
Meta Mutation Damage Score 0.4599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein receptor (LDLR) family. Low density lipoprotein receptors are cell surface proteins that play roles in both signal transduction and receptor-mediated endocytosis of specific ligands for lysosomal degradation. The encoded protein plays a critical role in the migration of neurons during development by mediating Reelin signaling, and also functions as a receptor for the cholesterol transport protein apolipoprotein E. Expression of this gene may be a marker for major depressive disorder. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired granule cell migration, radial glial scaffold formation, contextual fear conditioning, and long-term potentiation. Mutant males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Lrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Lrp8 APN 4 107864076 missense probably benign 0.04
IGL01514:Lrp8 APN 4 107855684 missense probably damaging 1.00
IGL02058:Lrp8 APN 4 107870109 missense probably benign 0.25
IGL02398:Lrp8 APN 4 107847494 missense probably damaging 0.97
IGL02398:Lrp8 APN 4 107869048 missense probably damaging 1.00
IGL02706:Lrp8 APN 4 107803319 nonsense probably null
IGL02754:Lrp8 APN 4 107834755 splice site probably null
IGL02967:Lrp8 APN 4 107861234 missense probably benign 0.21
IGL03080:Lrp8 APN 4 107855799 missense probably damaging 1.00
IGL02837:Lrp8 UTSW 4 107861281 missense probably benign 0.01
R0312:Lrp8 UTSW 4 107806855 intron probably benign
R0440:Lrp8 UTSW 4 107869098 missense probably damaging 0.99
R0598:Lrp8 UTSW 4 107857237 missense possibly damaging 0.73
R1627:Lrp8 UTSW 4 107854416 missense probably damaging 0.99
R1967:Lrp8 UTSW 4 107859971 missense probably damaging 1.00
R2183:Lrp8 UTSW 4 107803265 missense probably damaging 1.00
R2325:Lrp8 UTSW 4 107864009 missense probably benign 0.03
R3712:Lrp8 UTSW 4 107848302 missense probably benign 0.08
R4093:Lrp8 UTSW 4 107843271 nonsense probably null
R4706:Lrp8 UTSW 4 107861273 missense probably benign 0.00
R4765:Lrp8 UTSW 4 107854395 missense probably damaging 1.00
R4840:Lrp8 UTSW 4 107870037 missense possibly damaging 0.79
R4900:Lrp8 UTSW 4 107806809 intron probably benign
R5033:Lrp8 UTSW 4 107834755 splice site probably null
R5280:Lrp8 UTSW 4 107854321 missense probably damaging 1.00
R5381:Lrp8 UTSW 4 107869110 missense probably damaging 1.00
R5935:Lrp8 UTSW 4 107857296 missense probably damaging 1.00
R5972:Lrp8 UTSW 4 107869070 missense probably damaging 1.00
R6076:Lrp8 UTSW 4 107847459 missense possibly damaging 0.81
R6343:Lrp8 UTSW 4 107869156 splice site probably null
R6805:Lrp8 UTSW 4 107854320 missense probably damaging 0.99
R7100:Lrp8 UTSW 4 107802450 missense possibly damaging 0.93
R7262:Lrp8 UTSW 4 107847464 missense probably benign
R7717:Lrp8 UTSW 4 107834743 missense probably benign 0.00
Z1177:Lrp8 UTSW 4 107843332 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCTCCTAAGCGCCCACATG -3'
(R):5'- CCTTGGCTGAGGACAAATAGG -3'

Sequencing Primer
(F):5'- ACGAGCAGGTGGTCCTCATTG -3'
(R):5'- CAAATAGGATGTGGGCCGCTTG -3'
Posted On2014-10-02