Incidental Mutation 'R2208:Cyp4x1'
ID 236767
Institutional Source Beutler Lab
Gene Symbol Cyp4x1
Ensembl Gene ENSMUSG00000047155
Gene Name cytochrome P450, family 4, subfamily x, polypeptide 1
Synonyms Cyp4a28-ps
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 115106323-115134281 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 115126594 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 85 (Q85K)
Ref Sequence ENSEMBL: ENSMUSP00000102155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051400] [ENSMUST00000106545]
AlphaFold Q6A152
Predicted Effect probably benign
Transcript: ENSMUST00000051400
AA Change: Q111K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000059545
Gene: ENSMUSG00000047155
AA Change: Q111K

transmembrane domain 13 30 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
Pfam:p450 46 501 1.5e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106545
AA Change: Q85K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102155
Gene: ENSMUSG00000047155
AA Change: Q85K

low complexity region 6 17 N/A INTRINSIC
Pfam:p450 20 475 4.7e-118 PFAM
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes and is located within a cluster of genes belonging to this superfamily on chromosome 1. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The expression pattern of a similar rat protein suggests that this protein may be involved in neurovascular function in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Cyp4x1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cyp4x1 APN 4 115121948 missense probably benign 0.00
IGL00913:Cyp4x1 APN 4 115112863 missense probably benign 0.19
IGL02990:Cyp4x1 APN 4 115121749 missense probably benign 0.02
IGL03411:Cyp4x1 APN 4 115108785 missense probably benign 0.05
R0607:Cyp4x1 UTSW 4 115112826 missense probably damaging 1.00
R1148:Cyp4x1 UTSW 4 115126555 splice site probably benign
R1148:Cyp4x1 UTSW 4 115126555 splice site probably benign
R1426:Cyp4x1 UTSW 4 115112791 splice site probably benign
R1484:Cyp4x1 UTSW 4 115112901 missense probably damaging 1.00
R1675:Cyp4x1 UTSW 4 115127560 missense possibly damaging 0.94
R1718:Cyp4x1 UTSW 4 115111670 missense possibly damaging 0.75
R2325:Cyp4x1 UTSW 4 115124379 missense probably benign 0.40
R4223:Cyp4x1 UTSW 4 115112880 missense probably damaging 0.98
R4588:Cyp4x1 UTSW 4 115108797 missense probably damaging 1.00
R4717:Cyp4x1 UTSW 4 115121705 missense probably benign 0.02
R5522:Cyp4x1 UTSW 4 115121977 missense probably damaging 1.00
R5880:Cyp4x1 UTSW 4 115108721 missense possibly damaging 0.62
R5994:Cyp4x1 UTSW 4 115121945 missense probably benign
R6103:Cyp4x1 UTSW 4 115111667 missense probably damaging 1.00
R7733:Cyp4x1 UTSW 4 115120194 missense possibly damaging 0.50
R8113:Cyp4x1 UTSW 4 115110066 missense probably damaging 1.00
R8172:Cyp4x1 UTSW 4 115111677 missense possibly damaging 0.94
R8366:Cyp4x1 UTSW 4 115112866 missense probably benign 0.08
R8766:Cyp4x1 UTSW 4 115110065 missense probably damaging 1.00
R9453:Cyp4x1 UTSW 4 115133872 missense probably damaging 1.00
Z1177:Cyp4x1 UTSW 4 115110103 missense probably damaging 1.00
Z1177:Cyp4x1 UTSW 4 115127525 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-02