Incidental Mutation 'R2208:Dpysl5'
ID236771
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Namedihydropyrimidinase-like 5
SynonymsCRAM, CRMP-5, Crmp5
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R2208 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30711564-30799375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30791597 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 399 (D399N)
Ref Sequence ENSEMBL: ENSMUSP00000110377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000114729]
Predicted Effect probably damaging
Transcript: ENSMUST00000088081
AA Change: D399N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168
AA Change: D399N

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114729
AA Change: D399N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168
AA Change: D399N

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198503
Meta Mutation Damage Score 0.9385 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30745278 missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30788781 missense probably damaging 1.00
R0517:Dpysl5 UTSW 5 30778066 missense probably damaging 0.99
R0788:Dpysl5 UTSW 5 30788841 critical splice donor site probably null
R1716:Dpysl5 UTSW 5 30777994 missense probably benign 0.00
R2016:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R2965:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R4440:Dpysl5 UTSW 5 30792268 missense probably damaging 0.99
R4863:Dpysl5 UTSW 5 30784343 missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30792268 missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30791513 missense probably damaging 1.00
R6379:Dpysl5 UTSW 5 30777973 critical splice acceptor site probably null
R6621:Dpysl5 UTSW 5 30784469 critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30783195 missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30792298 missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30745461 missense probably benign
R7446:Dpysl5 UTSW 5 30778887 missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30745416 missense probably damaging 1.00
R8041:Dpysl5 UTSW 5 30796314 missense probably benign 0.28
Z1176:Dpysl5 UTSW 5 30778120 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAAATGACCACAGCTGGGG -3'
(R):5'- AGGAATGGTACCCAGAACTGTC -3'

Sequencing Primer
(F):5'- CTGGGGTAGCAAGTGCCTG -3'
(R):5'- GGAACATGGTCATCTGCATACCG -3'
Posted On2014-10-02