Mutagenetix > Incidental Mutation

Incidental Mutation 'R2208:Brca2'

236773

Institutional Source

Beutler Lab

Gene Symbol

Brca2

Ensembl Gene

ENSMUSG00000041147

Gene Name

breast cancer 2, early onset

Synonyms

Fancd1, RAB163

MMRRC Submission

040210-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2208 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150522630-150570329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 150532344 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 183 (D183E)

Ref Sequence

ENSEMBL: ENSMUSP00000144150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000044620
AA Change: D183E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: D183E

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200686

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201149

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202003
AA Change: D183E

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147
AA Change: D183E

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202313
AA Change: D183E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: D183E

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202975

Meta Mutation Damage Score

0.0896

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,194,403	N883K	probably benign	Het
Ahnak	T	C	19: 9,017,732	V5460A	probably benign	Het
Bco2	A	G	9: 50,533,455	V517A	probably damaging	Het
Ccdc142	T	C	6: 83,107,960		probably null	Het
Ccdc39	A	G	3: 33,841,178	L34P	probably damaging	Het
Cdc42bpb	T	A	12: 111,336,029	H198L	probably damaging	Het
Cdc73	T	A	1: 143,609,382	E516V	probably damaging	Het
Cep170b	T	A	12: 112,738,985	L1059Q	probably benign	Het
Chrm1	T	C	19: 8,678,099	L56P	probably damaging	Het
Clec4d	T	A	6: 123,265,355	V22D	probably damaging	Het
Cyp2c39	T	C	19: 39,560,961	Y308H	possibly damaging	Het
Cyp2d12	T	C	15: 82,556,936	L141P	probably damaging	Het
Cyp4x1	G	T	4: 115,126,594	Q85K	probably benign	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Enpp7	T	C	11: 118,988,762		probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fitm2	T	A	2: 163,472,684		probably benign	Het
Gm14139	T	A	2: 150,193,145	V462E	probably benign	Het
Gng10	T	A	4: 59,035,314	I26N	possibly damaging	Het
Gpr33	C	T	12: 52,023,453	V268I	probably benign	Het
Hmcn2	G	A	2: 31,380,297	C1182Y	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Krt36	C	T	11: 100,102,939	V358M	probably damaging	Het
Lmod3	T	C	6: 97,247,877	I328V	probably benign	Het
Lrp8	T	C	4: 107,855,790	V580A	probably damaging	Het
Masp2	T	C	4: 148,614,415	I651T	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Msi2	A	T	11: 88,590,108	S118T	probably damaging	Het
Muc19	T	C	15: 91,871,549		noncoding transcript	Het
Nabp1	G	A	1: 51,477,614	R32*	probably null	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Nup88	T	C	11: 70,965,719	D196G	probably damaging	Het
Olfr747	T	C	14: 50,681,563	I24V	probably benign	Het
Pax1	T	A	2: 147,365,802	I198N	probably damaging	Het
Pde3a	A	G	6: 141,250,347	E253G	probably damaging	Het
Phldb1	C	T	9: 44,696,131	R1192Q	probably damaging	Het
Pianp	C	A	6: 124,999,639	P137Q	probably damaging	Het
Prdm15	A	C	16: 97,799,264		probably null	Het
Ptprf	A	T	4: 118,269,172		probably benign	Het
Rfx7	A	G	9: 72,617,964	D812G	probably benign	Het
Rgs22	T	C	15: 36,050,232	T691A	probably benign	Het
Rundc3a	A	T	11: 102,402,088	S436C	probably damaging	Het
Sntb1	T	C	15: 55,906,318	T92A	possibly damaging	Het
Tarsl2	T	C	7: 65,682,848	S566P	probably damaging	Het
Tbc1d32	A	T	10: 56,150,792		probably null	Het
Tep1	T	C	14: 50,866,864	Q191R	probably benign	Het
Tmc2	C	A	2: 130,214,563		probably null	Het
Tns1	A	C	1: 74,079,240	I77S	probably damaging	Het
Trpd52l3	T	C	19: 30,004,246	W134R	probably damaging	Het
Vmn2r15	A	C	5: 109,297,443	N38K	possibly damaging	Het
Wdr90	A	T	17: 25,860,388	D257E	probably damaging	Het
Zbtb9	T	C	17: 26,974,124	C168R	possibly damaging	Het

Other mutations in Brca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Brca2	APN	5	150539898	missense	probably benign	0.18
IGL00392:Brca2	APN	5	150541240	missense	probably benign	0.02
IGL00557:Brca2	APN	5	150560538	missense	probably benign
IGL00798:Brca2	APN	5	150539463	missense	probably benign	0.30
IGL00933:Brca2	APN	5	150542404	missense	probably benign	0.04
IGL00964:Brca2	APN	5	150532310	missense	probably damaging	1.00
IGL01152:Brca2	APN	5	150542390	missense	probably damaging	0.99
IGL01577:Brca2	APN	5	150541620	nonsense	probably null
IGL01585:Brca2	APN	5	150539516	missense	possibly damaging	0.76
IGL01732:Brca2	APN	5	150542387	missense	probably benign	0.13
IGL01809:Brca2	APN	5	150531061	splice site	probably null
IGL01911:Brca2	APN	5	150567613	missense	probably damaging	0.96
IGL02113:Brca2	APN	5	150540979	missense	possibly damaging	0.95
IGL02313:Brca2	APN	5	150538661	missense	probably damaging	1.00
IGL02342:Brca2	APN	5	150542824	missense	possibly damaging	0.94
IGL02508:Brca2	APN	5	150543308	missense	possibly damaging	0.85
IGL02532:Brca2	APN	5	150550862	missense	probably damaging	1.00
IGL02646:Brca2	APN	5	150560790	missense	possibly damaging	0.89
IGL02738:Brca2	APN	5	150567035	missense	probably damaging	1.00
IGL02833:Brca2	APN	5	150541790	missense	possibly damaging	0.83
IGL02871:Brca2	APN	5	150542552	missense	probably benign	0.13
IGL02995:Brca2	APN	5	150529488	missense	probably damaging	1.00
IGL03105:Brca2	APN	5	150560485	missense	probably benign	0.02
BB007:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
BB017:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R0219:Brca2	UTSW	5	150523175	splice site	probably benign
R0416:Brca2	UTSW	5	150569392	missense	possibly damaging	0.93
R0441:Brca2	UTSW	5	150541857	missense	probably damaging	0.96
R0548:Brca2	UTSW	5	150544935	missense	probably damaging	0.96
R0745:Brca2	UTSW	5	150544882	splice site	probably benign
R0799:Brca2	UTSW	5	150560193	missense	probably damaging	0.99
R1165:Brca2	UTSW	5	150542747	missense	probably damaging	0.98
R1247:Brca2	UTSW	5	150541274	missense	probably damaging	1.00
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1444:Brca2	UTSW	5	150542450	missense	probably benign
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1584:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1599:Brca2	UTSW	5	150548713	nonsense	probably null
R1600:Brca2	UTSW	5	150560830	splice site	probably benign
R1822:Brca2	UTSW	5	150540198	missense	probably benign	0.06
R1824:Brca2	UTSW	5	150536922	missense	possibly damaging	0.94
R2037:Brca2	UTSW	5	150540669	missense	probably benign
R2131:Brca2	UTSW	5	150557129	missense	probably damaging	1.00
R2203:Brca2	UTSW	5	150539502	missense	possibly damaging	0.58
R2293:Brca2	UTSW	5	150560534	missense	possibly damaging	0.86
R2517:Brca2	UTSW	5	150539672	missense	probably benign	0.04
R2566:Brca2	UTSW	5	150541762	missense	probably benign	0.03
R3422:Brca2	UTSW	5	150543121	missense	possibly damaging	0.91
R3917:Brca2	UTSW	5	150540827	missense	probably damaging	0.96
R3946:Brca2	UTSW	5	150536704	missense	probably damaging	0.96
R4176:Brca2	UTSW	5	150539633	nonsense	probably null
R4255:Brca2	UTSW	5	150541169	missense	possibly damaging	0.92
R4450:Brca2	UTSW	5	150536053	missense	probably damaging	0.96
R4603:Brca2	UTSW	5	150536165	missense	possibly damaging	0.86
R4681:Brca2	UTSW	5	150552398	splice site	probably null
R4755:Brca2	UTSW	5	150559987	splice site	probably null
R4762:Brca2	UTSW	5	150531116	missense	probably benign	0.00
R4824:Brca2	UTSW	5	150539735	missense	probably damaging	1.00
R4887:Brca2	UTSW	5	150556937	missense	probably damaging	1.00
R5020:Brca2	UTSW	5	150560436	missense	probably damaging	1.00
R5159:Brca2	UTSW	5	150542108	missense	possibly damaging	0.93
R5216:Brca2	UTSW	5	150542980	missense	probably damaging	0.99
R5269:Brca2	UTSW	5	150539223	missense	possibly damaging	0.75
R5274:Brca2	UTSW	5	150539689	missense	probably benign	0.00
R5589:Brca2	UTSW	5	150557132	missense	possibly damaging	0.67
R5619:Brca2	UTSW	5	150557114	missense	probably damaging	0.96
R5641:Brca2	UTSW	5	150556899	missense	probably damaging	1.00
R5686:Brca2	UTSW	5	150540904	missense	probably benign	0.00
R5730:Brca2	UTSW	5	150569005	missense	possibly damaging	0.85
R5763:Brca2	UTSW	5	150548006	missense	possibly damaging	0.85
R5877:Brca2	UTSW	5	150543221	missense	possibly damaging	0.53
R5893:Brca2	UTSW	5	150569138	missense	probably benign	0.02
R5900:Brca2	UTSW	5	150541132	missense	probably benign	0.01
R5926:Brca2	UTSW	5	150534622	missense	probably benign	0.07
R5966:Brca2	UTSW	5	150543251	missense	probably damaging	0.99
R6025:Brca2	UTSW	5	150541575	frame shift	probably null
R6062:Brca2	UTSW	5	150556889	missense	probably damaging	0.96
R6141:Brca2	UTSW	5	150540637	missense	possibly damaging	0.91
R6244:Brca2	UTSW	5	150566978	missense	probably benign	0.08
R6508:Brca2	UTSW	5	150536593	missense	possibly damaging	0.91
R6519:Brca2	UTSW	5	150540979	missense	probably damaging	0.99
R6611:Brca2	UTSW	5	150536193	missense	probably damaging	0.99
R6698:Brca2	UTSW	5	150532394	missense	probably damaging	1.00
R6856:Brca2	UTSW	5	150540208	missense	possibly damaging	0.68
R6912:Brca2	UTSW	5	150541742	missense	probably damaging	0.99
R7002:Brca2	UTSW	5	150539918	missense	probably benign
R7025:Brca2	UTSW	5	150540478	missense	probably benign	0.39
R7151:Brca2	UTSW	5	150541436	missense	probably benign	0.12
R7202:Brca2	UTSW	5	150532354	missense	probably benign	0.03
R7365:Brca2	UTSW	5	150532337	missense	probably damaging	0.99
R7510:Brca2	UTSW	5	150536691	missense	possibly damaging	0.85
R7612:Brca2	UTSW	5	150540611	missense	probably benign	0.03
R7682:Brca2	UTSW	5	150543153	missense	probably benign
R7890:Brca2	UTSW	5	150539381	missense	possibly damaging	0.83
R7930:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R7940:Brca2	UTSW	5	150538733	missense	probably benign
R8054:Brca2	UTSW	5	150536504	missense	probably benign	0.02
R8056:Brca2	UTSW	5	150569306	missense	possibly damaging	0.85
R8080:Brca2	UTSW	5	150539892	missense	probably benign	0.11
R8094:Brca2	UTSW	5	150536169	missense	possibly damaging	0.85
R8306:Brca2	UTSW	5	150536663	missense	possibly damaging	0.91
R8401:Brca2	UTSW	5	150552352	missense	probably damaging	1.00
R8523:Brca2	UTSW	5	150560148	missense	possibly damaging	0.75
R8784:Brca2	UTSW	5	150548661	nonsense	probably null
R8791:Brca2	UTSW	5	150542596	missense	possibly damaging	0.92
R8832:Brca2	UTSW	5	150542146	missense	possibly damaging	0.91
R8838:Brca2	UTSW	5	150541540	missense	possibly damaging	0.91
R8845:Brca2	UTSW	5	150543382	missense	possibly damaging	0.85
R8898:Brca2	UTSW	5	150569033	missense	possibly damaging	0.53
R8914:Brca2	UTSW	5	150541743	missense	probably damaging	0.96
R8935:Brca2	UTSW	5	150568981	missense	possibly damaging	0.70
R9014:Brca2	UTSW	5	150541754	missense	probably benign
R9023:Brca2	UTSW	5	150541895	missense	probably benign	0.07
R9094:Brca2	UTSW	5	150552305	missense	probably benign	0.08
R9195:Brca2	UTSW	5	150539953	missense	possibly damaging	0.83
R9198:Brca2	UTSW	5	150536512	missense	possibly damaging	0.91
R9314:Brca2	UTSW	5	150550894	missense	probably damaging	0.96
R9408:Brca2	UTSW	5	150541517	missense	probably damaging	1.00
R9459:Brca2	UTSW	5	150540629	missense	probably damaging	0.98
R9512:Brca2	UTSW	5	150531081	missense	probably benign	0.40
R9622:Brca2	UTSW	5	150556945	missense	probably damaging	0.96
R9777:Brca2	UTSW	5	150557114	missense	probably damaging	0.99
Z1088:Brca2	UTSW	5	150542763	missense	probably damaging	0.96
Z1186:Brca2	UTSW	5	150536583	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGTGTGTATTATCCCTTTGACTTG -3'
(R):5'- TGTTCTACAAACACTTATCGCACAG -3'

Sequencing Primer
(F):5'- TGTATTATCCCTTTGACTTGAGAATC -3'
(R):5'- TATGGACAGTTGTGAGCCACCAC -3'

Posted On

2014-10-02