Incidental Mutation 'R2208:Ccdc142'
ID236774
Institutional Source Beutler Lab
Gene Symbol Ccdc142
Ensembl Gene ENSMUSG00000107499
Gene Namecoiled-coil domain containing 142
Synonyms
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R2208 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83101601-83108394 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 83107960 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101253] [ENSMUST00000101254] [ENSMUST00000113938]
Predicted Effect probably benign
Transcript: ENSMUST00000101253
SMART Domains Protein: ENSMUSP00000098811
Gene: ENSMUSG00000079511

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 70 91 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 238 263 N/A INTRINSIC
Pfam:CCDC142 286 714 1.6e-159 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101254
SMART Domains Protein: ENSMUSP00000098812
Gene: ENSMUSG00000107499

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 70 91 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 238 263 N/A INTRINSIC
Pfam:CCDC142 279 714 8.5e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113938
SMART Domains Protein: ENSMUSP00000109571
Gene: ENSMUSG00000030037

DomainStartEndE-ValueType
Pfam:MRP_L53 20 71 2.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203533
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Ccdc142
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4515001:Ccdc142 UTSW 6 83103257 missense probably benign 0.05
R0636:Ccdc142 UTSW 6 83107198 unclassified probably benign
R1828:Ccdc142 UTSW 6 83107481 missense probably damaging 1.00
R1973:Ccdc142 UTSW 6 83102563 missense probably benign
R2143:Ccdc142 UTSW 6 83102222 missense probably damaging 1.00
R4329:Ccdc142 UTSW 6 83107016 unclassified probably benign
R5230:Ccdc142 UTSW 6 83107796 missense probably damaging 1.00
R5619:Ccdc142 UTSW 6 83103622 missense probably benign 0.09
R7498:Ccdc142 UTSW 6 83103231 missense possibly damaging 0.94
R7710:Ccdc142 UTSW 6 83101696 missense probably benign 0.00
R7759:Ccdc142 UTSW 6 83107931 missense probably benign 0.04
R8045:Ccdc142 UTSW 6 83103426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTGGACATCTAGCCTGC -3'
(R):5'- CAAGTTTTCCAGGCTGTTGAGG -3'

Sequencing Primer
(F):5'- TCAAGCAAGACTTCGGAGTGGTC -3'
(R):5'- GGCTGTTGAGGCTGCTG -3'
Posted On2014-10-02