Incidental Mutation 'R2208:Ccdc142'
ID 236774
Institutional Source Beutler Lab
Gene Symbol Ccdc142
Ensembl Gene ENSMUSG00000107499
Gene Name coiled-coil domain containing 142
Synonyms A230058J24Rik
MMRRC Submission 040210-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 83078582-83085375 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 83084941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101253] [ENSMUST00000101254] [ENSMUST00000113938]
AlphaFold Q8CAI1
Predicted Effect probably benign
Transcript: ENSMUST00000101253
SMART Domains Protein: ENSMUSP00000098811
Gene: ENSMUSG00000079511

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 70 91 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 238 263 N/A INTRINSIC
Pfam:CCDC142 286 714 1.6e-159 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101254
SMART Domains Protein: ENSMUSP00000098812
Gene: ENSMUSG00000107499

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 70 91 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 238 263 N/A INTRINSIC
Pfam:CCDC142 279 714 8.5e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113938
SMART Domains Protein: ENSMUSP00000109571
Gene: ENSMUSG00000030037

DomainStartEndE-ValueType
Pfam:MRP_L53 20 71 2.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203533
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,995,096 (GRCm39) V5460A probably benign Het
Bco2 A G 9: 50,444,755 (GRCm39) V517A probably damaging Het
Brca2 T A 5: 150,455,809 (GRCm39) D183E probably damaging Het
Ccdc39 A G 3: 33,895,327 (GRCm39) L34P probably damaging Het
Cdc42bpb T A 12: 111,302,463 (GRCm39) H198L probably damaging Het
Cdc73 T A 1: 143,485,120 (GRCm39) E516V probably damaging Het
Cep170b T A 12: 112,705,419 (GRCm39) L1059Q probably benign Het
Chrm1 T C 19: 8,655,463 (GRCm39) L56P probably damaging Het
Clec4d T A 6: 123,242,314 (GRCm39) V22D probably damaging Het
Cplane1 T A 15: 8,223,887 (GRCm39) N883K probably benign Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp2d12 T C 15: 82,441,137 (GRCm39) L141P probably damaging Het
Cyp4x1 G T 4: 114,983,791 (GRCm39) Q85K probably benign Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Enpp7 T C 11: 118,879,588 (GRCm39) probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fitm2 T A 2: 163,314,604 (GRCm39) probably benign Het
Gng10 T A 4: 59,035,314 (GRCm39) I26N possibly damaging Het
Gpr33 C T 12: 52,070,236 (GRCm39) V268I probably benign Het
Hmcn2 G A 2: 31,270,309 (GRCm39) C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Krt36 C T 11: 99,993,765 (GRCm39) V358M probably damaging Het
Lmod3 T C 6: 97,224,838 (GRCm39) I328V probably benign Het
Lrp8 T C 4: 107,712,987 (GRCm39) V580A probably damaging Het
Masp2 T C 4: 148,698,872 (GRCm39) I651T probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Msi2 A T 11: 88,480,934 (GRCm39) S118T probably damaging Het
Muc19 T C 15: 91,755,747 (GRCm39) noncoding transcript Het
Nabp1 G A 1: 51,516,773 (GRCm39) R32* probably null Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nup88 T C 11: 70,856,545 (GRCm39) D196G probably damaging Het
Or11h4b T C 14: 50,919,020 (GRCm39) I24V probably benign Het
Pax1 T A 2: 147,207,722 (GRCm39) I198N probably damaging Het
Pde3a A G 6: 141,196,073 (GRCm39) E253G probably damaging Het
Phldb1 C T 9: 44,607,428 (GRCm39) R1192Q probably damaging Het
Pianp C A 6: 124,976,602 (GRCm39) P137Q probably damaging Het
Prdm15 A C 16: 97,600,464 (GRCm39) probably null Het
Ptprf A T 4: 118,126,369 (GRCm39) probably benign Het
Rfx7 A G 9: 72,525,246 (GRCm39) D812G probably benign Het
Rgs22 T C 15: 36,050,378 (GRCm39) T691A probably benign Het
Rundc3a A T 11: 102,292,914 (GRCm39) S436C probably damaging Het
Sntb1 T C 15: 55,769,714 (GRCm39) T92A possibly damaging Het
Tars3 T C 7: 65,332,596 (GRCm39) S566P probably damaging Het
Tbc1d32 A T 10: 56,026,888 (GRCm39) probably null Het
Tep1 T C 14: 51,104,321 (GRCm39) Q191R probably benign Het
Tmc2 C A 2: 130,056,483 (GRCm39) probably null Het
Tns1 A C 1: 74,118,399 (GRCm39) I77S probably damaging Het
Trpd52l3 T C 19: 29,981,646 (GRCm39) W134R probably damaging Het
Vmn2r15 A C 5: 109,445,309 (GRCm39) N38K possibly damaging Het
Wdr90 A T 17: 26,079,362 (GRCm39) D257E probably damaging Het
Zbtb9 T C 17: 27,193,098 (GRCm39) C168R possibly damaging Het
Zfp1004 T A 2: 150,035,065 (GRCm39) V462E probably benign Het
Other mutations in Ccdc142
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4515001:Ccdc142 UTSW 6 83,080,238 (GRCm39) missense probably benign 0.05
R0636:Ccdc142 UTSW 6 83,084,179 (GRCm39) unclassified probably benign
R1828:Ccdc142 UTSW 6 83,084,462 (GRCm39) missense probably damaging 1.00
R1973:Ccdc142 UTSW 6 83,079,544 (GRCm39) missense probably benign
R2143:Ccdc142 UTSW 6 83,079,203 (GRCm39) missense probably damaging 1.00
R4329:Ccdc142 UTSW 6 83,083,997 (GRCm39) unclassified probably benign
R5230:Ccdc142 UTSW 6 83,084,777 (GRCm39) missense probably damaging 1.00
R5619:Ccdc142 UTSW 6 83,080,603 (GRCm39) missense probably benign 0.09
R7498:Ccdc142 UTSW 6 83,080,212 (GRCm39) missense possibly damaging 0.94
R7710:Ccdc142 UTSW 6 83,078,677 (GRCm39) missense probably benign 0.00
R7759:Ccdc142 UTSW 6 83,084,912 (GRCm39) missense probably benign 0.04
R8045:Ccdc142 UTSW 6 83,080,407 (GRCm39) missense probably damaging 1.00
R8217:Ccdc142 UTSW 6 83,080,197 (GRCm39) missense probably damaging 1.00
R8706:Ccdc142 UTSW 6 83,080,678 (GRCm39) missense probably damaging 1.00
R8712:Ccdc142 UTSW 6 83,079,233 (GRCm39) missense probably damaging 1.00
R8974:Ccdc142 UTSW 6 83,078,963 (GRCm39) missense probably benign 0.00
R9059:Ccdc142 UTSW 6 83,079,400 (GRCm39) missense probably damaging 0.99
R9608:Ccdc142 UTSW 6 83,084,082 (GRCm39) nonsense probably null
R9631:Ccdc142 UTSW 6 83,084,142 (GRCm39) missense probably benign 0.10
R9647:Ccdc142 UTSW 6 83,079,259 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCTGGACATCTAGCCTGC -3'
(R):5'- CAAGTTTTCCAGGCTGTTGAGG -3'

Sequencing Primer
(F):5'- TCAAGCAAGACTTCGGAGTGGTC -3'
(R):5'- GGCTGTTGAGGCTGCTG -3'
Posted On 2014-10-02