Incidental Mutation 'R2208:Lmod3'
ID 236775
Institutional Source Beutler Lab
Gene Symbol Lmod3
Ensembl Gene ENSMUSG00000044086
Gene Name leiomodin 3 (fetal)
Synonyms 5430424A14Rik
MMRRC Submission 040210-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 97215495-97229720 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97224838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 328 (I328V)
Ref Sequence ENSEMBL: ENSMUSP00000093315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095655]
AlphaFold E9QA62
Predicted Effect probably benign
Transcript: ENSMUST00000095655
AA Change: I328V

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: I328V

DomainStartEndE-ValueType
Pfam:Tropomodulin 8 177 1.2e-13 PFAM
PDB:1IO0|A 248 406 9e-46 PDB
SCOP:d1a4ya_ 261 358 1e-3 SMART
low complexity region 407 427 N/A INTRINSIC
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,995,096 (GRCm39) V5460A probably benign Het
Bco2 A G 9: 50,444,755 (GRCm39) V517A probably damaging Het
Brca2 T A 5: 150,455,809 (GRCm39) D183E probably damaging Het
Ccdc142 T C 6: 83,084,941 (GRCm39) probably null Het
Ccdc39 A G 3: 33,895,327 (GRCm39) L34P probably damaging Het
Cdc42bpb T A 12: 111,302,463 (GRCm39) H198L probably damaging Het
Cdc73 T A 1: 143,485,120 (GRCm39) E516V probably damaging Het
Cep170b T A 12: 112,705,419 (GRCm39) L1059Q probably benign Het
Chrm1 T C 19: 8,655,463 (GRCm39) L56P probably damaging Het
Clec4d T A 6: 123,242,314 (GRCm39) V22D probably damaging Het
Cplane1 T A 15: 8,223,887 (GRCm39) N883K probably benign Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp2d12 T C 15: 82,441,137 (GRCm39) L141P probably damaging Het
Cyp4x1 G T 4: 114,983,791 (GRCm39) Q85K probably benign Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Enpp7 T C 11: 118,879,588 (GRCm39) probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fitm2 T A 2: 163,314,604 (GRCm39) probably benign Het
Gng10 T A 4: 59,035,314 (GRCm39) I26N possibly damaging Het
Gpr33 C T 12: 52,070,236 (GRCm39) V268I probably benign Het
Hmcn2 G A 2: 31,270,309 (GRCm39) C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Krt36 C T 11: 99,993,765 (GRCm39) V358M probably damaging Het
Lrp8 T C 4: 107,712,987 (GRCm39) V580A probably damaging Het
Masp2 T C 4: 148,698,872 (GRCm39) I651T probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Msi2 A T 11: 88,480,934 (GRCm39) S118T probably damaging Het
Muc19 T C 15: 91,755,747 (GRCm39) noncoding transcript Het
Nabp1 G A 1: 51,516,773 (GRCm39) R32* probably null Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nup88 T C 11: 70,856,545 (GRCm39) D196G probably damaging Het
Or11h4b T C 14: 50,919,020 (GRCm39) I24V probably benign Het
Pax1 T A 2: 147,207,722 (GRCm39) I198N probably damaging Het
Pde3a A G 6: 141,196,073 (GRCm39) E253G probably damaging Het
Phldb1 C T 9: 44,607,428 (GRCm39) R1192Q probably damaging Het
Pianp C A 6: 124,976,602 (GRCm39) P137Q probably damaging Het
Prdm15 A C 16: 97,600,464 (GRCm39) probably null Het
Ptprf A T 4: 118,126,369 (GRCm39) probably benign Het
Rfx7 A G 9: 72,525,246 (GRCm39) D812G probably benign Het
Rgs22 T C 15: 36,050,378 (GRCm39) T691A probably benign Het
Rundc3a A T 11: 102,292,914 (GRCm39) S436C probably damaging Het
Sntb1 T C 15: 55,769,714 (GRCm39) T92A possibly damaging Het
Tars3 T C 7: 65,332,596 (GRCm39) S566P probably damaging Het
Tbc1d32 A T 10: 56,026,888 (GRCm39) probably null Het
Tep1 T C 14: 51,104,321 (GRCm39) Q191R probably benign Het
Tmc2 C A 2: 130,056,483 (GRCm39) probably null Het
Tns1 A C 1: 74,118,399 (GRCm39) I77S probably damaging Het
Trpd52l3 T C 19: 29,981,646 (GRCm39) W134R probably damaging Het
Vmn2r15 A C 5: 109,445,309 (GRCm39) N38K possibly damaging Het
Wdr90 A T 17: 26,079,362 (GRCm39) D257E probably damaging Het
Zbtb9 T C 17: 27,193,098 (GRCm39) C168R possibly damaging Het
Zfp1004 T A 2: 150,035,065 (GRCm39) V462E probably benign Het
Other mutations in Lmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmod3 APN 6 97,229,258 (GRCm39) missense probably damaging 0.99
IGL00465:Lmod3 APN 6 97,224,822 (GRCm39) missense probably damaging 1.00
IGL01401:Lmod3 APN 6 97,229,513 (GRCm39) missense probably damaging 1.00
IGL02279:Lmod3 APN 6 97,224,633 (GRCm39) missense probably damaging 1.00
IGL02621:Lmod3 APN 6 97,215,796 (GRCm39) utr 3 prime probably benign
IGL03116:Lmod3 APN 6 97,224,156 (GRCm39) missense possibly damaging 0.92
Runted UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R0086:Lmod3 UTSW 6 97,224,306 (GRCm39) missense probably damaging 1.00
R0627:Lmod3 UTSW 6 97,225,032 (GRCm39) missense probably damaging 0.96
R4038:Lmod3 UTSW 6 97,225,275 (GRCm39) missense probably benign 0.06
R4913:Lmod3 UTSW 6 97,224,125 (GRCm39) splice site probably null
R5867:Lmod3 UTSW 6 97,224,963 (GRCm39) missense probably damaging 1.00
R5905:Lmod3 UTSW 6 97,224,575 (GRCm39) missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97,224,234 (GRCm39) missense probably damaging 1.00
R6183:Lmod3 UTSW 6 97,229,514 (GRCm39) missense probably damaging 1.00
R6210:Lmod3 UTSW 6 97,224,262 (GRCm39) missense probably damaging 1.00
R6527:Lmod3 UTSW 6 97,224,339 (GRCm39) missense probably benign 0.00
R7225:Lmod3 UTSW 6 97,224,345 (GRCm39) missense probably benign 0.34
R7531:Lmod3 UTSW 6 97,225,403 (GRCm39) missense probably benign 0.01
R7908:Lmod3 UTSW 6 97,225,434 (GRCm39) missense probably benign 0.05
R8022:Lmod3 UTSW 6 97,225,260 (GRCm39) missense probably benign
R8154:Lmod3 UTSW 6 97,224,941 (GRCm39) missense probably damaging 1.00
R8325:Lmod3 UTSW 6 97,224,379 (GRCm39) missense probably benign 0.06
R9149:Lmod3 UTSW 6 97,224,625 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCCTGGTAAGCAGATTCG -3'
(R):5'- CGACATGAAGGAACTCAACCTG -3'

Sequencing Primer
(F):5'- CTGGTAAGCAGATTCGTTACCAC -3'
(R):5'- GGAACTCAACCTGAACAACATTG -3'
Posted On 2014-10-02