Incidental Mutation 'R2208:Pianp'
ID 236778
Institutional Source Beutler Lab
Gene Symbol Pianp
Ensembl Gene ENSMUSG00000030329
Gene Name PILR alpha associated neural protein
Synonyms
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R2208 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 124996694-125003096 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 124999639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 137 (P137Q)
Ref Sequence ENSEMBL: ENSMUSP00000145297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032479] [ENSMUST00000159391] [ENSMUST00000160666] [ENSMUST00000160704] [ENSMUST00000161292] [ENSMUST00000162000] [ENSMUST00000162170]
AlphaFold Q6P1B3
Predicted Effect probably damaging
Transcript: ENSMUST00000032479
AA Change: P137Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032479
Gene: ENSMUSG00000030329
AA Change: P137Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 272 2.1e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159391
AA Change: P137Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124024
Gene: ENSMUSG00000030329
AA Change: P137Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 165 5.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160666
SMART Domains Protein: ENSMUSP00000125328
Gene: ENSMUSG00000030329

DomainStartEndE-ValueType
Pfam:AJAP1_PANP_C 4 63 5.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160704
AA Change: P137Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124160
Gene: ENSMUSG00000030329
AA Change: P137Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 272 2.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161292
SMART Domains Protein: ENSMUSP00000125600
Gene: ENSMUSG00000030329

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162000
AA Change: P137Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145297
Gene: ENSMUSG00000030329
AA Change: P137Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 130 240 3.3e-8 PFAM
low complexity region 251 264 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162170
AA Change: P137Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123940
Gene: ENSMUSG00000030329
AA Change: P137Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 131 240 6.5e-12 PFAM
low complexity region 251 264 N/A INTRINSIC
Meta Mutation Damage Score 0.1062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand for the paired immunoglobin-like type 2 receptor alpha, and so may be involved in immune regulation. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tarsl2 T C 7: 65,682,848 S566P probably damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Pianp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Pianp APN 6 125000683 missense possibly damaging 0.71
IGL02693:Pianp APN 6 125001635 missense possibly damaging 0.53
R0015:Pianp UTSW 6 125001540 missense probably damaging 1.00
R6470:Pianp UTSW 6 124999269 unclassified probably benign
R6755:Pianp UTSW 6 124999384 missense probably benign 0.33
R6800:Pianp UTSW 6 125001602 missense possibly damaging 0.93
R6964:Pianp UTSW 6 124999390 missense possibly damaging 0.86
R7553:Pianp UTSW 6 124999251 missense unknown
R8409:Pianp UTSW 6 124999251 missense unknown
R9128:Pianp UTSW 6 125000695 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCTACCCCATCAGGCTTTG -3'
(R):5'- TTTGCCAGCCTAGAACCTG -3'

Sequencing Primer
(F):5'- TACCCCATCAGGCTTTGAAGAGG -3'
(R):5'- TTTGCTGGAGACACTCACAG -3'
Posted On 2014-10-02