Incidental Mutation 'R2208:Tarsl2'
ID236780
Institutional Source Beutler Lab
Gene Symbol Tarsl2
Ensembl Gene ENSMUSG00000030515
Gene Namethreonyl-tRNA synthetase-like 2
SynonymsA530046H20Rik
MMRRC Submission 040210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R2208 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location65644898-65692091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65682848 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 566 (S566P)
Ref Sequence ENSEMBL: ENSMUSP00000032728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032728]
Predicted Effect probably damaging
Transcript: ENSMUST00000032728
AA Change: S566P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032728
Gene: ENSMUSG00000030515
AA Change: S566P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
coiled coil region 44 68 N/A INTRINSIC
Pfam:TGS 151 210 8.8e-14 PFAM
tRNA_SAD 316 365 1.26e-16 SMART
Pfam:tRNA-synt_2b 464 675 2.2e-35 PFAM
Pfam:HGTP_anticodon 687 778 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127354
Meta Mutation Damage Score 0.9017 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,194,403 N883K probably benign Het
Ahnak T C 19: 9,017,732 V5460A probably benign Het
Bco2 A G 9: 50,533,455 V517A probably damaging Het
Brca2 T A 5: 150,532,344 D183E probably damaging Het
Ccdc142 T C 6: 83,107,960 probably null Het
Ccdc39 A G 3: 33,841,178 L34P probably damaging Het
Cdc42bpb T A 12: 111,336,029 H198L probably damaging Het
Cdc73 T A 1: 143,609,382 E516V probably damaging Het
Cep170b T A 12: 112,738,985 L1059Q probably benign Het
Chrm1 T C 19: 8,678,099 L56P probably damaging Het
Clec4d T A 6: 123,265,355 V22D probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp2d12 T C 15: 82,556,936 L141P probably damaging Het
Cyp4x1 G T 4: 115,126,594 Q85K probably benign Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Enpp7 T C 11: 118,988,762 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fitm2 T A 2: 163,472,684 probably benign Het
Gm14139 T A 2: 150,193,145 V462E probably benign Het
Gng10 T A 4: 59,035,314 I26N possibly damaging Het
Gpr33 C T 12: 52,023,453 V268I probably benign Het
Hmcn2 G A 2: 31,380,297 C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt36 C T 11: 100,102,939 V358M probably damaging Het
Lmod3 T C 6: 97,247,877 I328V probably benign Het
Lrp8 T C 4: 107,855,790 V580A probably damaging Het
Masp2 T C 4: 148,614,415 I651T probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Msi2 A T 11: 88,590,108 S118T probably damaging Het
Muc19 T C 15: 91,871,549 noncoding transcript Het
Nabp1 G A 1: 51,477,614 R32* probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nup88 T C 11: 70,965,719 D196G probably damaging Het
Olfr747 T C 14: 50,681,563 I24V probably benign Het
Pax1 T A 2: 147,365,802 I198N probably damaging Het
Pde3a A G 6: 141,250,347 E253G probably damaging Het
Phldb1 C T 9: 44,696,131 R1192Q probably damaging Het
Pianp C A 6: 124,999,639 P137Q probably damaging Het
Prdm15 A C 16: 97,799,264 probably null Het
Ptprf A T 4: 118,269,172 probably benign Het
Rfx7 A G 9: 72,617,964 D812G probably benign Het
Rgs22 T C 15: 36,050,232 T691A probably benign Het
Rundc3a A T 11: 102,402,088 S436C probably damaging Het
Sntb1 T C 15: 55,906,318 T92A possibly damaging Het
Tbc1d32 A T 10: 56,150,792 probably null Het
Tep1 T C 14: 50,866,864 Q191R probably benign Het
Tmc2 C A 2: 130,214,563 probably null Het
Tns1 A C 1: 74,079,240 I77S probably damaging Het
Trpd52l3 T C 19: 30,004,246 W134R probably damaging Het
Vmn2r15 A C 5: 109,297,443 N38K possibly damaging Het
Wdr90 A T 17: 25,860,388 D257E probably damaging Het
Zbtb9 T C 17: 26,974,124 C168R possibly damaging Het
Other mutations in Tarsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tarsl2 APN 7 65652259 critical splice acceptor site probably null
IGL00470:Tarsl2 APN 7 65688908 missense probably benign 0.03
IGL00594:Tarsl2 APN 7 65676132 critical splice donor site probably null
IGL01352:Tarsl2 APN 7 65658910 missense possibly damaging 0.80
IGL01519:Tarsl2 APN 7 65663886 missense probably damaging 1.00
IGL01726:Tarsl2 APN 7 65682818 missense possibly damaging 0.46
IGL02370:Tarsl2 APN 7 65661165 missense probably benign 0.17
IGL02729:Tarsl2 APN 7 65682819 missense probably damaging 0.97
IGL03234:Tarsl2 APN 7 65652278 missense probably benign 0.06
gary UTSW 7 65688952 critical splice donor site probably null
smart_money UTSW 7 65678142 missense probably damaging 1.00
R0127:Tarsl2 UTSW 7 65664969 missense probably benign 0.19
R0153:Tarsl2 UTSW 7 65684081 missense probably damaging 1.00
R0605:Tarsl2 UTSW 7 65678071 missense probably damaging 1.00
R1070:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1450:Tarsl2 UTSW 7 65647496 missense probably benign 0.01
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R2142:Tarsl2 UTSW 7 65658897 missense probably benign
R2143:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2144:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2145:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R3713:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3715:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3914:Tarsl2 UTSW 7 65683808 missense probably benign 0.05
R3929:Tarsl2 UTSW 7 65684043 intron probably null
R4008:Tarsl2 UTSW 7 65678128 missense probably damaging 1.00
R4064:Tarsl2 UTSW 7 65652270 missense possibly damaging 0.90
R4367:Tarsl2 UTSW 7 65682819 missense probably damaging 0.97
R4652:Tarsl2 UTSW 7 65689969 missense probably damaging 1.00
R4825:Tarsl2 UTSW 7 65647554 missense probably benign 0.38
R4901:Tarsl2 UTSW 7 65691294 missense probably benign 0.05
R4999:Tarsl2 UTSW 7 65658935 missense probably damaging 0.99
R5423:Tarsl2 UTSW 7 65683819 missense probably benign 0.00
R5756:Tarsl2 UTSW 7 65675976 missense probably benign 0.22
R5772:Tarsl2 UTSW 7 65684125 missense probably damaging 1.00
R6160:Tarsl2 UTSW 7 65682779 missense probably benign 0.32
R6230:Tarsl2 UTSW 7 65686436 unclassified probably null
R6424:Tarsl2 UTSW 7 65655739 missense probably damaging 1.00
R6615:Tarsl2 UTSW 7 65678142 missense probably damaging 1.00
R6792:Tarsl2 UTSW 7 65662303 missense probably damaging 1.00
R7350:Tarsl2 UTSW 7 65658924 missense probably damaging 1.00
R7549:Tarsl2 UTSW 7 65647593 missense probably damaging 0.96
R7592:Tarsl2 UTSW 7 65658871 missense probably benign 0.01
R7634:Tarsl2 UTSW 7 65676012 missense probably damaging 0.99
R7710:Tarsl2 UTSW 7 65664969 missense probably benign 0.19
R7808:Tarsl2 UTSW 7 65652261 missense probably benign 0.01
R7875:Tarsl2 UTSW 7 65678151 missense probably benign 0.05
R7958:Tarsl2 UTSW 7 65678151 missense probably benign 0.05
Z1177:Tarsl2 UTSW 7 65652264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCCTGGTGTTAAAATCAGGC -3'
(R):5'- TCTTCATATGGTCACCATGGC -3'

Sequencing Primer
(F):5'- AAGAGCACTGCTGTTCTTGCAAG -3'
(R):5'- TATGGTCACCATGGCGACGAG -3'
Posted On2014-10-02