Mutagenetix > Incidental Mutation

Incidental Mutation 'R2208:Nfix'

236781

Institutional Source

Beutler Lab

Gene Symbol

Nfix

Ensembl Gene

ENSMUSG00000001911

Gene Name

nuclear factor I/X

Synonyms

MMRRC Submission

040210-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.502) question?

Stock #

R2208 (G1)

Quality Score

104

Status

Validated

Chromosome

Chromosomal Location

84699876-84800344 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CAAAAA to CAAAA at 84716247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000076715

SMART Domains

Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.1e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	322	7.4e-32	PFAM
Pfam:CTF_NFI	313	396	3.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099070

SMART Domains

Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.7e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	437	2.7e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109762

SMART Domains

Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1.1e-27	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	312	5.4e-32	PFAM
Pfam:CTF_NFI	305	387	3.6e-19	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000109764

SMART Domains

Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1e-28	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	494	9.8e-137	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000126806

SMART Domains

Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	7.1e-31	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	488	1.5e-83	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132236

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,194,403	N883K	probably benign	Het
Ahnak	T	C	19: 9,017,732	V5460A	probably benign	Het
Bco2	A	G	9: 50,533,455	V517A	probably damaging	Het
Brca2	T	A	5: 150,532,344	D183E	probably damaging	Het
Ccdc142	T	C	6: 83,107,960		probably null	Het
Ccdc39	A	G	3: 33,841,178	L34P	probably damaging	Het
Cdc42bpb	T	A	12: 111,336,029	H198L	probably damaging	Het
Cdc73	T	A	1: 143,609,382	E516V	probably damaging	Het
Cep170b	T	A	12: 112,738,985	L1059Q	probably benign	Het
Chrm1	T	C	19: 8,678,099	L56P	probably damaging	Het
Clec4d	T	A	6: 123,265,355	V22D	probably damaging	Het
Cyp2c39	T	C	19: 39,560,961	Y308H	possibly damaging	Het
Cyp2d12	T	C	15: 82,556,936	L141P	probably damaging	Het
Cyp4x1	G	T	4: 115,126,594	Q85K	probably benign	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Enpp7	T	C	11: 118,988,762		probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fitm2	T	A	2: 163,472,684		probably benign	Het
Gm14139	T	A	2: 150,193,145	V462E	probably benign	Het
Gng10	T	A	4: 59,035,314	I26N	possibly damaging	Het
Gpr33	C	T	12: 52,023,453	V268I	probably benign	Het
Hmcn2	G	A	2: 31,380,297	C1182Y	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Krt36	C	T	11: 100,102,939	V358M	probably damaging	Het
Lmod3	T	C	6: 97,247,877	I328V	probably benign	Het
Lrp8	T	C	4: 107,855,790	V580A	probably damaging	Het
Masp2	T	C	4: 148,614,415	I651T	probably damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Msi2	A	T	11: 88,590,108	S118T	probably damaging	Het
Muc19	T	C	15: 91,871,549		noncoding transcript	Het
Nabp1	G	A	1: 51,477,614	R32*	probably null	Het
Nup88	T	C	11: 70,965,719	D196G	probably damaging	Het
Olfr747	T	C	14: 50,681,563	I24V	probably benign	Het
Pax1	T	A	2: 147,365,802	I198N	probably damaging	Het
Pde3a	A	G	6: 141,250,347	E253G	probably damaging	Het
Phldb1	C	T	9: 44,696,131	R1192Q	probably damaging	Het
Pianp	C	A	6: 124,999,639	P137Q	probably damaging	Het
Prdm15	A	C	16: 97,799,264		probably null	Het
Ptprf	A	T	4: 118,269,172		probably benign	Het
Rfx7	A	G	9: 72,617,964	D812G	probably benign	Het
Rgs22	T	C	15: 36,050,232	T691A	probably benign	Het
Rundc3a	A	T	11: 102,402,088	S436C	probably damaging	Het
Sntb1	T	C	15: 55,906,318	T92A	possibly damaging	Het
Tarsl2	T	C	7: 65,682,848	S566P	probably damaging	Het
Tbc1d32	A	T	10: 56,150,792		probably null	Het
Tep1	T	C	14: 50,866,864	Q191R	probably benign	Het
Tmc2	C	A	2: 130,214,563		probably null	Het
Tns1	A	C	1: 74,079,240	I77S	probably damaging	Het
Trpd52l3	T	C	19: 30,004,246	W134R	probably damaging	Het
Vmn2r15	A	C	5: 109,297,443	N38K	possibly damaging	Het
Wdr90	A	T	17: 25,860,388	D257E	probably damaging	Het
Zbtb9	T	C	17: 26,974,124	C168R	possibly damaging	Het

Other mutations in Nfix

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Nfix	APN	8	84726477	missense	probably damaging	0.99
IGL01919:Nfix	APN	8	84726474	missense	probably damaging	1.00
IGL01950:Nfix	APN	8	84713786	makesense	probably null
IGL02862:Nfix	APN	8	84713846	missense	probably benign	0.07
R0142:Nfix	UTSW	8	84721686	missense	probably damaging	1.00
R0309:Nfix	UTSW	8	84721774	missense	probably damaging	1.00
R0600:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0622:Nfix	UTSW	8	84726482	missense	probably damaging	0.99
R0628:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0882:Nfix	UTSW	8	84727925	missense	probably damaging	1.00
R0893:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0974:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0975:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1014:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1015:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1162:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1241:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1381:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1513:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1521:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1618:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1865:Nfix	UTSW	8	84772275	missense	possibly damaging	0.73
R1912:Nfix	UTSW	8	84721677	missense	probably damaging	1.00
R1974:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R2251:Nfix	UTSW	8	84716170	missense	probably benign	0.03
R2268:Nfix	UTSW	8	84716247	frame shift	probably null
R2270:Nfix	UTSW	8	84716247	frame shift	probably null
R2272:Nfix	UTSW	8	84727175	missense	probably damaging	1.00
R2346:Nfix	UTSW	8	84716247	frame shift	probably null
R2350:Nfix	UTSW	8	84716247	frame shift	probably null
R2963:Nfix	UTSW	8	84716247	frame shift	probably null
R2983:Nfix	UTSW	8	84716247	frame shift	probably null
R3008:Nfix	UTSW	8	84716247	frame shift	probably null
R3727:Nfix	UTSW	8	84716247	frame shift	probably null
R3791:Nfix	UTSW	8	84716247	frame shift	probably null
R4163:Nfix	UTSW	8	84716247	frame shift	probably null
R4164:Nfix	UTSW	8	84716247	frame shift	probably null
R4201:Nfix	UTSW	8	84716247	frame shift	probably null
R4206:Nfix	UTSW	8	84716247	frame shift	probably null
R4609:Nfix	UTSW	8	84726490	missense	probably damaging	1.00
R4801:Nfix	UTSW	8	84716247	frame shift	probably null
R4802:Nfix	UTSW	8	84716247	frame shift	probably null
R4914:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4915:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4916:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4918:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R5013:Nfix	UTSW	8	84772084	missense	possibly damaging	0.86
R5290:Nfix	UTSW	8	84713777	nonsense	probably null
R6418:Nfix	UTSW	8	84727149	missense	probably benign	0.01
R6554:Nfix	UTSW	8	84727650	missense	possibly damaging	0.93
R6786:Nfix	UTSW	8	84727647	missense	probably damaging	1.00
R8853:Nfix	UTSW	8	84727647	missense	probably damaging	1.00
R9014:Nfix	UTSW	8	84721776	missense	possibly damaging	0.95
T0970:Nfix	UTSW	8	84726483	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCTGGCTGGAGTAACTGAG -3'
(R):5'- TGTGCCTAGAGGAAAGGACC -3'

Sequencing Primer
(F):5'- CCTCTCTTTGCAGTGGAGAC -3'
(R):5'- GAGGAAAGGACCCTCCCTC -3'

Posted On

2014-10-02